Incidental Mutation 'R0086:Tpm3'
ID19882
Institutional Source Beutler Lab
Gene Symbol Tpm3
Ensembl Gene ENSMUSG00000027940
Gene Nametropomyosin 3, gamma
SynonymsskalphaTM.2, Trop-5, Tpm5, hTMnm, Tm5NM, gamma-TM, Tpm-5, hTM30nm
MMRRC Submission 038373-MU
Accession Numbers

Ncbi RefSeq: NM_022314.3, NM_001253738.1, NM_001253740.1; MGI:1890149

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90072649-90100902 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 90090092 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029549] [ENSMUST00000118566] [ENSMUST00000119158] [ENSMUST00000119570] [ENSMUST00000121503] [ENSMUST00000127955] [ENSMUST00000149432]
Predicted Effect probably benign
Transcript: ENSMUST00000029549
SMART Domains Protein: ENSMUSP00000029549
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 3.9e-22 PFAM
Pfam:Tropomyosin 12 248 7.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118566
SMART Domains Protein: ENSMUSP00000113056
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 2e-21 PFAM
Pfam:Tropomyosin 12 248 1.7e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119158
SMART Domains Protein: ENSMUSP00000113219
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 1.7e-22 PFAM
Pfam:Tropomyosin 12 247 3.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119570
SMART Domains Protein: ENSMUSP00000113978
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 8 154 4.2e-35 PFAM
Pfam:CLZ 10 75 1.2e-9 PFAM
Pfam:Tropomyosin 49 285 3.7e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121503
SMART Domains Protein: ENSMUSP00000113578
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.3e-36 PFAM
Pfam:Tropomyosin 48 284 4.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149115
Predicted Effect probably benign
Transcript: ENSMUST00000149432
SMART Domains Protein: ENSMUSP00000114229
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin 1 70 1.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151798
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype Strain: 3040795
Lethality: E1-E3
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous inactivation of this gene results in early embryonic death, prior to blastocyst formation. Mice homozygous for a targeted allele lacking exon 9 exhibit dysmorphic T-tubules and contraction in skeletal muscles. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(5) Gene trapped(71)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Tpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Tpm3 APN 3 90087717 missense probably damaging 0.99
IGL00949:Tpm3 APN 3 90089858 missense probably damaging 1.00
IGL01955:Tpm3 APN 3 90088435 missense probably benign 0.00
IGL01970:Tpm3 APN 3 90089828 missense probably damaging 1.00
IGL02605:Tpm3 APN 3 90088446 missense probably benign 0.13
IGL03352:Tpm3 APN 3 90087745 critical splice donor site probably null
IGL03375:Tpm3 APN 3 90073772 missense possibly damaging 0.83
P0045:Tpm3 UTSW 3 90091093 critical splice donor site probably null
R0006:Tpm3 UTSW 3 90087661 splice site probably benign
R0006:Tpm3 UTSW 3 90087661 splice site probably benign
R0024:Tpm3 UTSW 3 90087449 splice site probably null
R1487:Tpm3 UTSW 3 90090082 splice site probably null
R5235:Tpm3 UTSW 3 90086495 missense probably damaging 1.00
R6639:Tpm3 UTSW 3 90079802 missense probably damaging 0.99
R7089:Tpm3 UTSW 3 90072722 start gained probably benign
R7212:Tpm3 UTSW 3 90091054 missense probably benign
R7867:Tpm3 UTSW 3 90086468 missense probably damaging 1.00
X0020:Tpm3 UTSW 3 90087574 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTCAAATGGCTTAGAGGCAC -3'
(R):5'- GCACAGCAGTCTTAGTGACTCTCC -3'

Sequencing Primer
(F):5'- TGGCTTAGAGGCACGAGAG -3'
(R):5'- ATCTGTTCAGGCTGCAAGAC -3'
Posted On2013-04-11