Incidental Mutation 'R0086:Synpo2'
ID19884
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Namesynaptopodin 2
Synonyms1110069I04Rik, Myo, 9530006G20Rik, 2310068J10Rik, myopodin
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123076519-123236149 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123117104 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 297 (C297*)
Ref Sequence ENSEMBL: ENSMUSP00000142508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
Predicted Effect probably benign
Transcript: ENSMUST00000051443
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106426
AA Change: C297*
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: C297*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106427
AA Change: C297*
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: C297*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139160
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198584
AA Change: C297*
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: C297*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 123113210 missense probably damaging 1.00
IGL00742:Synpo2 APN 3 123113876 missense probably damaging 1.00
IGL01890:Synpo2 APN 3 123112497 missense probably damaging 1.00
IGL02268:Synpo2 APN 3 123116983 missense probably damaging 1.00
IGL02323:Synpo2 APN 3 123117534 missense probably benign 0.00
IGL02745:Synpo2 APN 3 123113612 missense probably damaging 1.00
IGL03001:Synpo2 APN 3 123079955 missense probably benign 0.00
IGL03177:Synpo2 APN 3 123121215 missense probably damaging 1.00
IGL03336:Synpo2 APN 3 123114179 missense possibly damaging 0.60
R0126:Synpo2 UTSW 3 123079862 missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 123113793 missense probably benign 0.02
R0284:Synpo2 UTSW 3 123079734 nonsense probably null
R0388:Synpo2 UTSW 3 123079897 missense probably benign
R0457:Synpo2 UTSW 3 123112772 missense probably damaging 1.00
R0483:Synpo2 UTSW 3 123114332 missense probably damaging 1.00
R0615:Synpo2 UTSW 3 123117287 missense probably damaging 1.00
R0646:Synpo2 UTSW 3 123114449 missense probably damaging 1.00
R0666:Synpo2 UTSW 3 123114059 missense probably damaging 0.98
R0743:Synpo2 UTSW 3 123112706 missense probably benign 0.02
R0791:Synpo2 UTSW 3 123113186 missense probably benign
R1531:Synpo2 UTSW 3 123117666 missense probably benign 0.03
R1587:Synpo2 UTSW 3 123114398 missense probably damaging 0.98
R1717:Synpo2 UTSW 3 123112554 missense probably damaging 1.00
R1807:Synpo2 UTSW 3 123080257 missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 123079888 missense probably benign 0.01
R2987:Synpo2 UTSW 3 123116973 missense probably damaging 1.00
R3019:Synpo2 UTSW 3 123113579 missense probably damaging 1.00
R3939:Synpo2 UTSW 3 123114590 missense probably damaging 1.00
R4050:Synpo2 UTSW 3 123114278 missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 123117150 missense probably damaging 1.00
R4669:Synpo2 UTSW 3 123113063 missense probably damaging 1.00
R4724:Synpo2 UTSW 3 123114291 missense probably damaging 1.00
R4825:Synpo2 UTSW 3 123114419 missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123235901 critical splice donor site probably null
R5292:Synpo2 UTSW 3 123114060 missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 123117682 nonsense probably null
R5701:Synpo2 UTSW 3 123080230 missense probably damaging 1.00
R5712:Synpo2 UTSW 3 123121210 missense probably damaging 1.00
R5730:Synpo2 UTSW 3 123114119 missense probably benign 0.04
R5879:Synpo2 UTSW 3 123114297 missense probably damaging 1.00
R5979:Synpo2 UTSW 3 123117411 missense probably damaging 1.00
R6290:Synpo2 UTSW 3 123117052 missense probably damaging 0.98
R6384:Synpo2 UTSW 3 123113049 nonsense probably null
R6498:Synpo2 UTSW 3 123080232 synonymous probably null
R7123:Synpo2 UTSW 3 123113186 missense probably benign
R7153:Synpo2 UTSW 3 123112404 makesense probably null
R7233:Synpo2 UTSW 3 123117684 missense probably benign 0.01
R7301:Synpo2 UTSW 3 123114053 missense probably benign 0.10
R7318:Synpo2 UTSW 3 123117319 missense probably benign
R7366:Synpo2 UTSW 3 123114041 missense probably damaging 0.96
R7630:Synpo2 UTSW 3 123080032 missense probably damaging 1.00
R8068:Synpo2 UTSW 3 123117392 missense possibly damaging 0.59
Z1177:Synpo2 UTSW 3 123113010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGAAACCTTGTTAAAGGCACC -3'
(R):5'- ATCCCTGCTCCTGAGAAAGCAGAC -3'

Sequencing Primer
(F):5'- AACAGTTCCTGCATCTTTGGG -3'
(R):5'- AGCAGACACTTCTCTGACG -3'
Posted On2013-04-11