Incidental Mutation 'R1729:Ehf'
ID 198872
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 039761-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R1729 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 103093776-103133620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103104251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 186 (T186P)
Ref Sequence ENSEMBL: ENSMUSP00000121103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788] [ENSMUST00000140503] [ENSMUST00000151265]
AlphaFold O70273
Predicted Effect probably benign
Transcript: ENSMUST00000090475
AA Change: T175P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: T175P

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111174
AA Change: T175P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: T175P

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111176
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125788
AA Change: T186P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350
AA Change: T186P

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Predicted Effect probably benign
Transcript: ENSMUST00000140503
SMART Domains Protein: ENSMUSP00000114979
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 70 154 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151265
SMART Domains Protein: ENSMUSP00000118275
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 225 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,844 (GRCm39) probably benign Het
4930453N24Rik T C 16: 64,589,385 (GRCm39) I90V probably damaging Het
Aadat A G 8: 60,979,746 (GRCm39) T203A probably damaging Het
Adam34l T C 8: 44,078,620 (GRCm39) N535D probably damaging Het
Adamts17 C T 7: 66,799,704 (GRCm39) R1060* probably null Het
Adamts5 T A 16: 85,674,803 (GRCm39) K454* probably null Het
Adgrg6 T C 10: 14,315,526 (GRCm39) T593A probably damaging Het
Aldh1l2 T A 10: 83,343,946 (GRCm39) K377* probably null Het
Aldh4a1 A G 4: 139,371,472 (GRCm39) Y462C probably damaging Het
Ankrd12 G T 17: 66,291,071 (GRCm39) P1454Q probably benign Het
Ap2m1 T A 16: 20,358,088 (GRCm39) N35K probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Atr G A 9: 95,779,634 (GRCm39) V1331I probably benign Het
Boc T C 16: 44,316,782 (GRCm39) T454A probably benign Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Car14 G A 3: 95,808,560 (GRCm39) P18L possibly damaging Het
Cbs G T 17: 31,839,923 (GRCm39) A337E probably benign Het
Ccdc186 A C 19: 56,797,652 (GRCm39) H306Q probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cdk12 T C 11: 98,140,796 (GRCm39) probably benign Het
Cep350 A T 1: 155,787,727 (GRCm39) H1370Q probably benign Het
Cfh T C 1: 140,064,526 (GRCm39) K374R probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chat A T 14: 32,168,752 (GRCm39) L261H probably damaging Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Clcn1 T A 6: 42,276,448 (GRCm39) F360Y possibly damaging Het
Clgn A G 8: 84,149,659 (GRCm39) S387G probably damaging Het
Clk1 C T 1: 58,460,420 (GRCm39) R70Q probably damaging Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Cspg4 G T 9: 56,805,821 (GRCm39) V2211L probably benign Het
Cwh43 T C 5: 73,565,561 (GRCm39) L42P probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
D830039M14Rik C T 10: 61,311,506 (GRCm39) probably benign Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dhx30 T C 9: 109,927,819 (GRCm39) H101R probably damaging Het
Dnah11 T A 12: 117,880,666 (GRCm39) D3818V probably damaging Het
Dnah9 G A 11: 65,975,846 (GRCm39) T1401I possibly damaging Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Elf2 A T 3: 51,164,993 (GRCm39) V277D probably damaging Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Eya2 G T 2: 165,529,583 (GRCm39) G109W probably damaging Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fam78b A G 1: 166,829,199 (GRCm39) D22G possibly damaging Het
Fastkd2 T A 1: 63,790,459 (GRCm39) C628* probably null Het
Fat3 A C 9: 15,907,611 (GRCm39) V2797G possibly damaging Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Fut10 T A 8: 31,691,418 (GRCm39) S88T probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Gon4l T A 3: 88,810,405 (GRCm39) D1844E probably damaging Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Guk1 A T 11: 59,076,138 (GRCm39) V100E probably damaging Het
Ifi44l T C 3: 151,468,456 (GRCm39) I25V unknown Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Itprid1 T C 6: 55,945,526 (GRCm39) F749S probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif18b A G 11: 102,806,367 (GRCm39) probably null Het
Kif26a T C 12: 112,143,219 (GRCm39) S1158P possibly damaging Het
Kmt2d A G 15: 98,763,013 (GRCm39) C279R probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Krt23 A T 11: 99,383,790 (GRCm39) V34D probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Mb21d2 A G 16: 28,647,173 (GRCm39) V267A probably benign Het
Megf10 T C 18: 57,373,864 (GRCm39) probably null Het
Mfrp A G 9: 44,015,884 (GRCm39) T334A possibly damaging Het
Miga2 A G 2: 30,258,980 (GRCm39) H63R probably damaging Het
Mrgbp T A 2: 180,227,242 (GRCm39) N192K probably damaging Het
Mrgpra2b A G 7: 47,114,627 (GRCm39) I35T probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ndufaf7 A T 17: 79,245,058 (GRCm39) K59M probably damaging Het
Necab3 T C 2: 154,388,795 (GRCm39) S208G probably benign Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Npnt G A 3: 132,620,158 (GRCm39) Q112* probably null Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrcam A G 12: 44,620,633 (GRCm39) K893E probably benign Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or8b12i A T 9: 20,082,209 (GRCm39) Y219* probably null Het
Otoa T C 7: 120,724,662 (GRCm39) V447A probably benign Het
Patj G A 4: 98,320,017 (GRCm39) G428D possibly damaging Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pkn2 G A 3: 142,516,462 (GRCm39) P555S probably benign Het
Pla2g12a A G 3: 129,688,589 (GRCm39) E149G probably benign Het
Plec C A 15: 76,061,892 (GRCm39) E2547* probably null Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rab3gap1 T G 1: 127,870,223 (GRCm39) L948R probably damaging Het
Rbsn A T 6: 92,167,000 (GRCm39) L548Q possibly damaging Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Rint1 T A 5: 24,014,841 (GRCm39) D352E probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep G C 1: 135,211,715 (GRCm39) A11G probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr G T 1: 119,990,976 (GRCm39) E453D probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Slain2 A G 5: 73,114,957 (GRCm39) H396R probably damaging Het
Slc22a5 G A 11: 53,757,177 (GRCm39) P491L probably damaging Het
Slc26a4 A G 12: 31,594,493 (GRCm39) V285A possibly damaging Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc9a8 T C 2: 167,266,065 (GRCm39) F14S probably benign Het
Spock3 T C 8: 63,802,011 (GRCm39) L330P probably damaging Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Synpo2l G A 14: 20,715,887 (GRCm39) P233S probably damaging Het
Tasor A T 14: 27,201,590 (GRCm39) N1367Y probably damaging Het
Tbc1d19 T G 5: 53,986,714 (GRCm39) I41S probably damaging Het
Tecta G A 9: 42,303,218 (GRCm39) T138I probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tmem241 T A 18: 12,201,369 (GRCm39) H157L probably damaging Het
Tnfrsf25 T A 4: 152,202,761 (GRCm39) probably null Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Traf3ip3 T A 1: 192,864,201 (GRCm39) Q394L probably benign Het
Traf7 A G 17: 24,731,353 (GRCm39) F228L probably damaging Het
Trhr A G 15: 44,060,549 (GRCm39) E23G probably damaging Het
Trim59 T C 3: 68,944,186 (GRCm39) T385A probably benign Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Tubgcp2 T C 7: 139,577,968 (GRCm39) T779A probably benign Het
Tusc2 A T 9: 107,441,830 (GRCm39) I68F probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Usp24 A G 4: 106,217,618 (GRCm39) N447S possibly damaging Het
Usp42 T C 5: 143,700,381 (GRCm39) D1214G probably damaging Het
Vmn2r73 T C 7: 85,507,086 (GRCm39) Y742C probably damaging Het
Wdfy4 A T 14: 32,817,962 (GRCm39) S1473T possibly damaging Het
Zan C A 5: 137,413,280 (GRCm39) probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zfyve9 A C 4: 108,575,698 (GRCm39) V461G possibly damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103,097,185 (GRCm39) splice site probably null
IGL01296:Ehf APN 2 103,098,500 (GRCm39) splice site probably null
IGL02095:Ehf APN 2 103,097,336 (GRCm39) missense probably damaging 1.00
R0399:Ehf UTSW 2 103,097,215 (GRCm39) missense probably damaging 1.00
R1116:Ehf UTSW 2 103,097,354 (GRCm39) missense probably damaging 1.00
R1728:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R2240:Ehf UTSW 2 103,104,420 (GRCm39) missense probably benign
R2287:Ehf UTSW 2 103,097,469 (GRCm39) missense possibly damaging 0.89
R2397:Ehf UTSW 2 103,107,164 (GRCm39) missense probably damaging 0.99
R4094:Ehf UTSW 2 103,121,095 (GRCm39) intron probably benign
R4687:Ehf UTSW 2 103,097,471 (GRCm39) missense probably damaging 1.00
R4930:Ehf UTSW 2 103,097,202 (GRCm39) missense probably damaging 1.00
R5695:Ehf UTSW 2 103,097,124 (GRCm39) missense probably damaging 1.00
R5925:Ehf UTSW 2 103,097,338 (GRCm39) splice site probably null
R6656:Ehf UTSW 2 103,113,928 (GRCm39) missense probably damaging 1.00
R8217:Ehf UTSW 2 103,109,976 (GRCm39) missense possibly damaging 0.94
R9008:Ehf UTSW 2 103,097,173 (GRCm39) missense
Z1176:Ehf UTSW 2 103,109,863 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCTGATGGCAACTCAGTTCAC -3'
(R):5'- AGAATGGGAACTCTTCCACCCAGG -3'

Sequencing Primer
(F):5'- CACTCCCTGGCTTTTTAATGAG -3'
(R):5'- TATCTCTATGATCCCAGCTATGGTAG -3'
Posted On 2014-05-23