Incidental Mutation 'R0086:Nlrp9a'
ID19894
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26558547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 530 (C530Y)
Ref Sequence ENSEMBL: ENSMUSP00000113318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
Predicted Effect probably damaging
Transcript: ENSMUST00000071780
AA Change: C530Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102
AA Change: C530Y

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108387
AA Change: C530Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: C530Y

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117252
AA Change: C530Y

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102
AA Change: C530Y

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122040
AA Change: C530Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102
AA Change: C530Y

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143149
Predicted Effect possibly damaging
Transcript: ENSMUST00000153452
AA Change: C441Y

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102
AA Change: C441Y

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26573788 splice site probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26560741 missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26571407 missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26557656 missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26557296 missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26562581 missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26560835 missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26557253 missense probably benign 0.34
Z1176:Nlrp9a UTSW 7 26558229 missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26557456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATGACCTCAGGAGGAATGGGAT -3'
(R):5'- ATGCAGACAATATGGAGTTGCTGACAT -3'

Sequencing Primer
(F):5'- GTTATTGGAAACCTCGCTCAAC -3'
(R):5'- GGAGTTGCTGACATATCATCAACATC -3'
Posted On2013-04-11