Incidental Mutation 'R0086:Shkbp1'
ID19895
Institutional Source Beutler Lab
Gene Symbol Shkbp1
Ensembl Gene ENSMUSG00000089832
Gene NameSh3kbp1 binding protein 1
SynonymsB930062H15Rik, SB1
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0086 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location27342133-27356019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27352026 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 203 (H203N)
Ref Sequence ENSEMBL: ENSMUSP00000003857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003857] [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably benign
Transcript: ENSMUST00000003857
AA Change: H203N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832
AA Change: H203N

DomainStartEndE-ValueType
BTB 19 119 1.65e-16 SMART
low complexity region 183 194 N/A INTRINSIC
Blast:WD40 196 271 1e-21 BLAST
WD40 277 313 1.9e2 SMART
WD40 419 457 3.45e-1 SMART
WD40 527 577 3.68e1 SMART
low complexity region 612 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108362
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108363
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108364
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123190
Predicted Effect probably benign
Transcript: ENSMUST00000126587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157078
Predicted Effect probably benign
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Meta Mutation Damage Score 0.0915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Shkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Shkbp1 APN 7 27355251 missense probably benign 0.28
IGL01469:Shkbp1 APN 7 27355941 missense probably benign
IGL01787:Shkbp1 APN 7 27342450 missense possibly damaging 0.93
IGL02149:Shkbp1 APN 7 27342639 unclassified probably benign
IGL02902:Shkbp1 APN 7 27342716 missense probably damaging 0.97
R0219:Shkbp1 UTSW 7 27352061 missense probably benign 0.01
R0485:Shkbp1 UTSW 7 27348581 missense probably damaging 1.00
R1036:Shkbp1 UTSW 7 27345296 missense possibly damaging 0.86
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1608:Shkbp1 UTSW 7 27354779 missense probably benign 0.01
R1757:Shkbp1 UTSW 7 27342351 missense probably benign
R1968:Shkbp1 UTSW 7 27355400 critical splice donor site probably null
R2763:Shkbp1 UTSW 7 27347029 missense probably benign 0.05
R3027:Shkbp1 UTSW 7 27343393 missense probably benign 0.18
R3924:Shkbp1 UTSW 7 27342402 missense probably benign
R4425:Shkbp1 UTSW 7 27343302 missense probably benign 0.38
R5048:Shkbp1 UTSW 7 27352096 unclassified probably benign
R5862:Shkbp1 UTSW 7 27343404 nonsense probably null
R5955:Shkbp1 UTSW 7 27342524 missense probably benign
R6016:Shkbp1 UTSW 7 27354401 missense possibly damaging 0.92
R6226:Shkbp1 UTSW 7 27351980 missense probably null 1.00
R6362:Shkbp1 UTSW 7 27351695 critical splice donor site probably null
R6382:Shkbp1 UTSW 7 27352059 nonsense probably null
R6460:Shkbp1 UTSW 7 27350538 missense probably benign 0.01
R6647:Shkbp1 UTSW 7 27342375 missense probably benign
R7025:Shkbp1 UTSW 7 27355281 missense possibly damaging 0.47
R7255:Shkbp1 UTSW 7 27342748 missense possibly damaging 0.93
R7522:Shkbp1 UTSW 7 27347158 missense possibly damaging 0.88
R7571:Shkbp1 UTSW 7 27347131 missense possibly damaging 0.90
R8207:Shkbp1 UTSW 7 27352684 missense probably benign 0.01
Z1177:Shkbp1 UTSW 7 27347001 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCCACCATCTTGTCATGC -3'
(R):5'- ATGCTGAACTAGCTCCCCTGACTC -3'

Sequencing Primer
(F):5'- TTGTCATGCTCACCCGGAG -3'
(R):5'- ctcccctgactccAGCC -3'
Posted On2013-04-11