Incidental Mutation 'R0086:Polr2i'
ID19896
Institutional Source Beutler Lab
Gene Symbol Polr2i
Ensembl Gene ENSMUSG00000019738
Gene Namepolymerase (RNA) II (DNA directed) polypeptide I
Synonyms
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0086 (G1)
Quality Score192
Status Validated
Chromosome7
Chromosomal Location30231948-30233390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30233086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 73 (V73M)
Ref Sequence ENSEMBL: ENSMUSP00000116741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006254] [ENSMUST00000019882] [ENSMUST00000108192] [ENSMUST00000108193] [ENSMUST00000149654] [ENSMUST00000189482]
Predicted Effect probably benign
Transcript: ENSMUST00000006254
SMART Domains Protein: ENSMUSP00000006254
Gene: ENSMUSG00000006095

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 10 94 9.6e-30 PFAM
low complexity region 135 152 N/A INTRINSIC
CAP_GLY 161 230 4.76e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000019882
AA Change: V95M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019882
Gene: ENSMUSG00000019738
AA Change: V95M

DomainStartEndE-ValueType
RPOL9 15 68 1.22e-24 SMART
ZnF_C2C2 84 125 2.18e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108192
AA Change: V73M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103827
Gene: ENSMUSG00000019738
AA Change: V73M

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
ZnF_C2C2 62 103 2.18e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108193
AA Change: S114N
SMART Domains Protein: ENSMUSP00000103828
Gene: ENSMUSG00000019738
AA Change: S114N

DomainStartEndE-ValueType
Pfam:RNA_POL_M_15KD 14 41 1.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145559
Predicted Effect probably damaging
Transcript: ENSMUST00000149654
AA Change: V73M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116741
Gene: ENSMUSG00000019738
AA Change: V73M

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
Blast:ZnF_C2C2 62 83 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150841
Predicted Effect probably benign
Transcript: ENSMUST00000189482
SMART Domains Protein: ENSMUSP00000140811
Gene: ENSMUSG00000100512

DomainStartEndE-ValueType
ZnF_C2H2 69 91 3.2e-4 SMART
ZnF_C2H2 97 119 1.4e-6 SMART
ZnF_C2H2 125 148 3.2e-5 SMART
ZnF_C2H2 164 186 5.3e-4 SMART
Meta Mutation Damage Score 0.6635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with two other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. The product of this gene has two zinc finger motifs with conserved cysteines and the subunit does possess zinc binding activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Polr2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Polr2i APN 7 30232392 missense possibly damaging 0.71
R0594:Polr2i UTSW 7 30232745 splice site probably null
R1474:Polr2i UTSW 7 30232802 missense probably damaging 1.00
R1730:Polr2i UTSW 7 30233068 missense probably damaging 1.00
R1783:Polr2i UTSW 7 30233068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGATTACCAGCAGGAAGCC -3'
(R):5'- GAAGGAACGATCACTCAGTCCAGC -3'

Sequencing Primer
(F):5'- CGGCCTGACCGCTAATTAC -3'
(R):5'- GCATGGCGTCCTAGCAATAAG -3'
Posted On2013-04-11