Incidental Mutation 'R0086:Gns'
ID19900
Institutional Source Beutler Lab
Gene Symbol Gns
Ensembl Gene ENSMUSG00000034707
Gene Nameglucosamine (N-acetyl)-6-sulfatase
SynonymsG6S, 2610016K11Rik
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121365090-121397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121391473 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 463 (D463N)
Ref Sequence ENSEMBL: ENSMUSP00000043167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040344]
Predicted Effect probably damaging
Transcript: ENSMUST00000040344
AA Change: D463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043167
Gene: ENSMUSG00000034707
AA Change: D463N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Sulfatase 39 376 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219216
Meta Mutation Damage Score 0.4295 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in progressive lysosomal glycosaminoglycan accumulation in the central nervous system and peripheral organs and causes hypoactivity and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Gns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Gns APN 10 121390693 missense probably benign 0.01
PIT4402001:Gns UTSW 10 121376706 missense probably damaging 1.00
R0344:Gns UTSW 10 121383423 missense probably benign 0.04
R0544:Gns UTSW 10 121376267 nonsense probably null
R0626:Gns UTSW 10 121383444 critical splice donor site probably null
R1770:Gns UTSW 10 121378047 missense probably benign 0.00
R2142:Gns UTSW 10 121392778 missense probably damaging 1.00
R4036:Gns UTSW 10 121371190 missense probably damaging 1.00
R4451:Gns UTSW 10 121376696 missense probably damaging 1.00
R4569:Gns UTSW 10 121381178 missense probably benign 0.00
R5264:Gns UTSW 10 121380185 missense probably benign 0.12
R5467:Gns UTSW 10 121391446 missense probably benign 0.00
R7268:Gns UTSW 10 121376652 missense probably damaging 1.00
R7588:Gns UTSW 10 121390658 missense probably benign 0.18
R8083:Gns UTSW 10 121378103 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCCACCTGAGATGCTGATGC -3'
(R):5'- AGCCCTATTACCAGGCCAACTGAG -3'

Sequencing Primer
(F):5'- GATGCTGTGTCAGAACAATCCTC -3'
(R):5'- AGAGGACTCCATTGAGAAAACTC -3'
Posted On2013-04-11