Incidental Mutation 'R0086:Agap2'
ID19901
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 2
SynonymsCentg1
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127075284-127093169 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 127087882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000217941]
Predicted Effect probably null
Transcript: ENSMUST00000039259
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217941
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 127087996 missense unknown
IGL01690:Agap2 APN 10 127082958 splice site probably benign
IGL01765:Agap2 APN 10 127083235 missense unknown
IGL02029:Agap2 APN 10 127080283 missense unknown
IGL02525:Agap2 APN 10 127083201 splice site probably null
IGL03019:Agap2 APN 10 127091562 splice site probably benign
R0197:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R0345:Agap2 UTSW 10 127087895 missense unknown
R0363:Agap2 UTSW 10 127090965 missense probably damaging 1.00
R0682:Agap2 UTSW 10 127083482 missense unknown
R0787:Agap2 UTSW 10 127085150 missense unknown
R0882:Agap2 UTSW 10 127087450 missense unknown
R0883:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R1445:Agap2 UTSW 10 127091112 splice site probably benign
R1800:Agap2 UTSW 10 127091671 missense probably damaging 1.00
R1854:Agap2 UTSW 10 127080516 missense unknown
R1925:Agap2 UTSW 10 127090875 missense probably damaging 1.00
R1986:Agap2 UTSW 10 127083044 nonsense probably null
R2050:Agap2 UTSW 10 127080261 nonsense probably null
R2267:Agap2 UTSW 10 127082428 splice site probably benign
R2269:Agap2 UTSW 10 127082428 splice site probably benign
R4174:Agap2 UTSW 10 127090514 missense probably damaging 0.98
R4397:Agap2 UTSW 10 127090483 missense unknown
R4418:Agap2 UTSW 10 127091650 missense probably damaging 1.00
R4472:Agap2 UTSW 10 127091213 missense probably damaging 1.00
R4612:Agap2 UTSW 10 127080096 missense unknown
R4690:Agap2 UTSW 10 127091375 missense possibly damaging 0.91
R4744:Agap2 UTSW 10 127090203 critical splice donor site probably null
R5316:Agap2 UTSW 10 127082427 splice site probably null
R5533:Agap2 UTSW 10 127083042 missense unknown
R5680:Agap2 UTSW 10 127088011 missense unknown
R6010:Agap2 UTSW 10 127090910 missense probably damaging 1.00
R6276:Agap2 UTSW 10 127089360 critical splice donor site probably null
R6356:Agap2 UTSW 10 127082996 missense unknown
R7138:Agap2 UTSW 10 127087285 missense unknown
R7154:Agap2 UTSW 10 127091655 missense probably benign 0.34
R7497:Agap2 UTSW 10 127090965 missense probably damaging 0.99
R7718:Agap2 UTSW 10 127079865 missense possibly damaging 0.68
R7720:Agap2 UTSW 10 127091088 missense probably damaging 0.96
R7893:Agap2 UTSW 10 127080195 missense unknown
Z1088:Agap2 UTSW 10 127088242 missense unknown
Z1176:Agap2 UTSW 10 127080225 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCATTCAGAGAGTGTTTCCAGACC -3'
(R):5'- TGTCAGTGAACCAGTCTCCCTACC -3'

Sequencing Primer
(F):5'- AGTGTTTCCAGACCAAGTCTGAC -3'
(R):5'- GTCATGGACCCCACTTACCAG -3'
Posted On2013-04-11