Incidental Mutation 'R0086:Mfsd6l'
ID19903
Institutional Source Beutler Lab
Gene Symbol Mfsd6l
Ensembl Gene ENSMUSG00000048329
Gene Namemajor facilitator superfamily domain containing 6-like
Synonyms
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68556186-68558245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68556565 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000061601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053211] [ENSMUST00000060441] [ENSMUST00000102613]
Predicted Effect probably benign
Transcript: ENSMUST00000053211
AA Change: T81A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061601
Gene: ENSMUSG00000048329
AA Change: T81A

DomainStartEndE-ValueType
Pfam:MFS_1_like 28 88 1.6e-7 PFAM
transmembrane domain 284 303 N/A INTRINSIC
transmembrane domain 318 340 N/A INTRINSIC
Pfam:MFS_1 365 555 4e-11 PFAM
low complexity region 557 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060441
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Mfsd6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mfsd6l APN 11 68556473 missense probably damaging 1.00
IGL02292:Mfsd6l APN 11 68557750 missense probably benign 0.00
R0180:Mfsd6l UTSW 11 68556545 missense possibly damaging 0.87
R1547:Mfsd6l UTSW 11 68556608 missense probably damaging 0.98
R4831:Mfsd6l UTSW 11 68556505 missense probably benign 0.00
R4881:Mfsd6l UTSW 11 68557922 missense probably benign 0.04
R5237:Mfsd6l UTSW 11 68557270 missense probably benign 0.26
R5244:Mfsd6l UTSW 11 68557175 missense possibly damaging 0.94
R5867:Mfsd6l UTSW 11 68557210 missense possibly damaging 0.94
R5961:Mfsd6l UTSW 11 68556542 missense possibly damaging 0.69
R7337:Mfsd6l UTSW 11 68557283 missense possibly damaging 0.93
R7343:Mfsd6l UTSW 11 68557048 missense possibly damaging 0.74
R7526:Mfsd6l UTSW 11 68558038 missense probably damaging 1.00
R7686:Mfsd6l UTSW 11 68557226 missense probably benign 0.01
R7715:Mfsd6l UTSW 11 68557550 missense probably damaging 1.00
Z1177:Mfsd6l UTSW 11 68556982 missense possibly damaging 0.80
Z1177:Mfsd6l UTSW 11 68557714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGATTCTCCCTTCCCAGGATATG -3'
(R):5'- TGCAGACCGCTAAATGTTCCTTCAG -3'

Sequencing Primer
(F):5'- GTCTGGCAGAATCCCGTAAC -3'
(R):5'- CCTTCAGATCCATTTGGAAAGC -3'
Posted On2013-04-11