Mutagenetix > Incidental Mutation

Incidental Mutation 'R0086:Pcnx'

19907

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

038373-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 81992058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005] [ENSMUST00000222468]

AlphaFold

Q9QYC1

Predicted Effect

probably benign
Transcript: ENSMUST00000021567

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221472

Predicted Effect

probably benign
Transcript: ENSMUST00000221675

Predicted Effect

probably benign
Transcript: ENSMUST00000221721

Predicted Effect

probably benign
Transcript: ENSMUST00000222005

Predicted Effect

probably benign
Transcript: ENSMUST00000222468

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.0%
10x: 94.6%
20x: 86.6%

Validation Efficiency

96% (91/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	A	15: 82,062,601	V233D	probably benign	Het
Abcg8	T	C	17: 84,692,771	V252A	probably damaging	Het
Adam39	C	T	8: 40,826,360	T596I	possibly damaging	Het
Agap2	C	A	10: 127,087,882		probably null	Het
Ap4b1	T	G	3: 103,814,860	V50G	probably damaging	Het
Atp13a1	T	A	8: 69,797,774	I381N	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Birc6	T	C	17: 74,593,166	V1113A	possibly damaging	Het
C1galt1	T	A	6: 7,867,051		probably benign	Het
Capza2	A	G	6: 17,660,774	K158E	probably damaging	Het
Cenpe	C	T	3: 135,264,424		probably benign	Het
Cercam	T	C	2: 29,871,064	L42P	probably damaging	Het
Cfap54	T	C	10: 93,028,594	E807G	possibly damaging	Het
Cog6	A	G	3: 52,993,570	V157A	probably damaging	Het
Cts6	A	T	13: 61,196,457		probably benign	Het
Cyp2c39	A	T	19: 39,510,913	I15F	unknown	Het
Dock7	A	T	4: 98,945,144	V1970D	probably damaging	Het
Exph5	A	G	9: 53,337,930	D73G	possibly damaging	Het
Gjc2	A	T	11: 59,176,846	M270K	probably benign	Het
Gns	G	A	10: 121,391,473	D463N	probably damaging	Het
Hoxd8	G	T	2: 74,705,932	G129W	probably damaging	Het
Ina	A	G	19: 47,023,591	T483A	possibly damaging	Het
Lmod3	T	A	6: 97,247,345	Q505L	probably damaging	Het
Map3k13	A	G	16: 21,914,225	N526D	probably damaging	Het
Map3k2	A	T	18: 32,218,468	I435F	probably damaging	Het
Mfsd6l	A	G	11: 68,556,565	T81A	probably benign	Het
Micall1	T	C	15: 79,125,489		probably benign	Het
Mkrn2	G	T	6: 115,613,335	M217I	possibly damaging	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Ncapg	A	G	5: 45,676,744		probably null	Het
Nlrp9a	G	A	7: 26,558,547	C530Y	probably damaging	Het
Numb	T	C	12: 83,795,930	T442A	probably damaging	Het
Oip5	C	T	2: 119,617,929		probably benign	Het
Olfr1224-ps1	C	T	2: 89,156,476	R233H	probably benign	Het
Olfr342	A	T	2: 36,527,450	I13F	possibly damaging	Het
Olfr639	A	G	7: 104,012,054	I216T	probably benign	Het
Olfr936	T	C	9: 39,046,895	T175A	probably benign	Het
Pkhd1l1	T	A	15: 44,556,008	N2956K	possibly damaging	Het
Plcl1	T	A	1: 55,715,583	W1030R	probably damaging	Het
Polr2i	G	A	7: 30,233,086	V73M	probably damaging	Het
Prr14l	T	A	5: 32,831,559		probably benign	Het
Pxdn	G	T	12: 30,002,419	R865L	possibly damaging	Het
Scnn1a	T	C	6: 125,342,587		probably benign	Het
Shkbp1	G	T	7: 27,352,026	H203N	probably benign	Het
Skiv2l2	G	T	13: 112,927,328	F10L	probably benign	Het
Slc22a14	C	T	9: 119,222,738		probably benign	Het
Snap29	C	A	16: 17,428,236	T240K	probably damaging	Het
Sp2	C	A	11: 96,957,427	G457C	probably damaging	Het
Ssr2	C	T	3: 88,576,880		probably benign	Het
Synpo2	A	T	3: 123,117,104	C297*	probably null	Het
Tpm3	T	A	3: 90,090,092		probably benign	Het
Trmt6	CTG	C	2: 132,809,017		probably benign	Het
Trp63	T	C	16: 25,871,087	Y431H	probably damaging	Het
Tuba3b	T	A	6: 145,621,160	C376S	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Ulk1	G	A	5: 110,787,707		probably benign	Het
Usp24	T	C	4: 106,392,360	S1425P	probably damaging	Het
Xdh	T	C	17: 73,884,438	I1335V	probably benign	Het
Zmynd15	T	C	11: 70,464,232	Y352H	probably damaging	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8202:Pcnx	UTSW	12	81895047	missense	probably benign	0.00
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
R8803:Pcnx	UTSW	12	81993151	missense	possibly damaging	0.85
R8820:Pcnx	UTSW	12	81973248	missense
R8828:Pcnx	UTSW	12	81995823	missense	probably damaging	1.00
R8946:Pcnx	UTSW	12	81971384	missense	probably damaging	0.96
R8964:Pcnx	UTSW	12	81993038	missense
R9152:Pcnx	UTSW	12	81975815	missense
R9256:Pcnx	UTSW	12	81973273	missense
R9289:Pcnx	UTSW	12	81982079	missense
R9414:Pcnx	UTSW	12	81918204	missense	probably damaging	1.00
R9445:Pcnx	UTSW	12	81918207	missense	probably damaging	0.98
R9595:Pcnx	UTSW	12	81918914	missense
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- TGCCCCACAGGTGAACAAGGAATG -3'
(R):5'- GCTCTGCTGATGTTGCCACAGATAC -3'

Sequencing Primer
(F):5'- ATGCCAAGCAGGCACTG -3'
(R):5'- GATGTTGCCACAGATACATCAG -3'

Posted On

2013-04-11