Incidental Mutation 'R0086:Numb'
ID19908
Institutional Source Beutler Lab
Gene Symbol Numb
Ensembl Gene ENSMUSG00000021224
Gene NameNUMB endocytic adaptor protein
Synonymsm-numb
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83794034-83921934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83795930 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 442 (T442A)
Ref Sequence ENSEMBL: ENSMUSP00000021647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000021647] [ENSMUST00000085215] [ENSMUST00000110298] [ENSMUST00000117217] [ENSMUST00000121733] [ENSMUST00000129335] [ENSMUST00000154043]
PDB Structure
Solution structure of phosphotyrosine interaction domain of mouse Numb protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021646
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021647
AA Change: T442A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224
AA Change: T442A

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085215
SMART Domains Protein: ENSMUSP00000082311
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 322 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110298
SMART Domains Protein: ENSMUSP00000105927
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PID 39 76 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117217
AA Change: T431A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113591
Gene: ENSMUSG00000021224
AA Change: T431A

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 4.5e-42 PFAM
low complexity region 402 423 N/A INTRINSIC
low complexity region 434 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121733
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129335
AA Change: T491A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119303
Gene: ENSMUSG00000021224
AA Change: T491A

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 258 338 9.9e-32 PFAM
low complexity region 462 483 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154043
AA Change: T480A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117899
Gene: ENSMUSG00000021224
AA Change: T480A

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 5.1e-42 PFAM
low complexity region 451 472 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: This gene encodes a conserved protein that is distributed asymmetrically during cell division in the developing embryo. The encoded protein participates in cell fate decisions by interacting with the Notch receptor. Loss of function of this gene results in severe defects in neural development and loss of viability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele die at ~E11.5 with neural tube closure defects and precocious cortical neurogenesis. Mice homozygous for another null allele show impaired axial rotation, neural tube closure, angiogenic remodeling, placenta formation, and motor and sensory neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Numb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Numb APN 12 83808132 missense probably damaging 1.00
IGL01979:Numb APN 12 83842277 missense probably damaging 1.00
IGL02318:Numb APN 12 83831918 intron probably null
IGL02716:Numb APN 12 83801208 missense possibly damaging 0.79
IGL03206:Numb APN 12 83825296 splice site probably benign
PIT4468001:Numb UTSW 12 83808147 missense probably damaging 0.99
R0626:Numb UTSW 12 83795840 missense probably damaging 0.97
R0652:Numb UTSW 12 83795792 missense probably damaging 1.00
R1201:Numb UTSW 12 83801285 missense probably damaging 0.99
R1295:Numb UTSW 12 83796161 splice site probably benign
R1433:Numb UTSW 12 83797259 missense probably damaging 0.98
R1489:Numb UTSW 12 83795443 missense probably damaging 1.00
R1606:Numb UTSW 12 83801010 splice site probably null
R1980:Numb UTSW 12 83797344 critical splice acceptor site probably null
R3771:Numb UTSW 12 83799576 missense probably damaging 0.99
R5382:Numb UTSW 12 83808205 missense probably damaging 1.00
R5818:Numb UTSW 12 83825254 splice site probably null
R5846:Numb UTSW 12 83876747 utr 5 prime probably benign
R6360:Numb UTSW 12 83797262 missense probably damaging 0.99
R6384:Numb UTSW 12 83803974 missense probably damaging 1.00
R7186:Numb UTSW 12 83796146 missense probably damaging 1.00
R7469:Numb UTSW 12 83803804 missense probably benign 0.37
R7749:Numb UTSW 12 83801277 missense not run
Predicted Primers PCR Primer
(F):5'- GCAGTGCCAAACACATTGGCTACC -3'
(R):5'- ATGCCTTCAGATGACATCGTGCTC -3'

Sequencing Primer
(F):5'- ACACATTGGCTACCATCTGG -3'
(R):5'- TGACATCGTGCTCTAACAGG -3'
Posted On2013-04-11