Incidental Mutation 'R0086:Skiv2l2'
ID19910
Institutional Source Beutler Lab
Gene Symbol Skiv2l2
Ensembl Gene ENSMUSG00000016018
Gene Namesuperkiller viralicidic activity 2-like 2 (S. cerevisiae)
Synonyms2610528A15Rik
MMRRC Submission 038373-MU
Accession Numbers

Ncbi RefSeq: NM_028151.2; MGI:1919448

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112867418-112927398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112927328 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000022281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022281] [ENSMUST00000038574] [ENSMUST00000224176]
Predicted Effect probably benign
Transcript: ENSMUST00000022281
AA Change: F10L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018
AA Change: F10L

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DEXDc 134 317 6.42e-34 SMART
HELICc 437 526 3.14e-19 SMART
Pfam:rRNA_proc-arch 580 839 1.7e-91 PFAM
DSHCT 863 1040 1.69e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038574
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223866
Predicted Effect probably benign
Transcript: ENSMUST00000224176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225997
Meta Mutation Damage Score 0.2058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Skiv2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Skiv2l2 APN 13 112914489 missense probably damaging 1.00
IGL01772:Skiv2l2 APN 13 112891325 missense probably benign 0.10
IGL01843:Skiv2l2 APN 13 112918561 splice site probably benign
IGL01972:Skiv2l2 APN 13 112881061 missense probably damaging 1.00
IGL02451:Skiv2l2 APN 13 112891347 missense probably damaging 1.00
IGL02716:Skiv2l2 APN 13 112883146 missense probably benign 0.13
IGL03234:Skiv2l2 APN 13 112880975 splice site probably benign
K3955:Skiv2l2 UTSW 13 112910979 nonsense probably null
P0038:Skiv2l2 UTSW 13 112910979 nonsense probably null
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0687:Skiv2l2 UTSW 13 112914361 missense probably damaging 1.00
R1216:Skiv2l2 UTSW 13 112914342 splice site probably benign
R1218:Skiv2l2 UTSW 13 112917622 missense probably damaging 1.00
R1312:Skiv2l2 UTSW 13 112883251 nonsense probably null
R1827:Skiv2l2 UTSW 13 112913099 critical splice donor site probably null
R1852:Skiv2l2 UTSW 13 112872927 missense probably benign 0.00
R1889:Skiv2l2 UTSW 13 112887490 missense probably benign 0.00
R2205:Skiv2l2 UTSW 13 112898890 missense probably benign 0.06
R2256:Skiv2l2 UTSW 13 112876512 missense probably damaging 0.98
R2394:Skiv2l2 UTSW 13 112883168 missense probably benign 0.02
R3717:Skiv2l2 UTSW 13 112895595 missense probably damaging 1.00
R3779:Skiv2l2 UTSW 13 112903392 splice site probably benign
R4613:Skiv2l2 UTSW 13 112921739 nonsense probably null
R4939:Skiv2l2 UTSW 13 112909892 missense possibly damaging 0.91
R5452:Skiv2l2 UTSW 13 112913181 missense probably null 0.96
R5591:Skiv2l2 UTSW 13 112927356 start codon destroyed probably null 0.88
R5688:Skiv2l2 UTSW 13 112873056 nonsense probably null
R5761:Skiv2l2 UTSW 13 112917662 missense probably damaging 0.96
R5789:Skiv2l2 UTSW 13 112891285 missense probably benign 0.01
R5851:Skiv2l2 UTSW 13 112908952 missense probably damaging 1.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6348:Skiv2l2 UTSW 13 112910917 missense possibly damaging 0.88
R7276:Skiv2l2 UTSW 13 112914439 missense probably benign 0.00
R7397:Skiv2l2 UTSW 13 112921686 missense probably benign
R7792:Skiv2l2 UTSW 13 112872909 missense probably benign 0.02
R7863:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7946:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7948:Skiv2l2 UTSW 13 112921762 missense probably benign 0.02
R8035:Skiv2l2 UTSW 13 112898802 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGCATGGCCTAAGGAAGCCAC -3'
(R):5'- GCTCAAGGCTCGCTCACTTTTGAC -3'

Sequencing Primer
(F):5'- TAAGGAAGCCACGCTGC -3'
(R):5'- ACTTTTGACTCCTCCGGGC -3'
Posted On2013-04-11