Incidental Mutation 'R0086:Snap29'
ID19913
Institutional Source Beutler Lab
Gene Symbol Snap29
Ensembl Gene ENSMUSG00000022765
Gene Namesynaptosomal-associated protein 29
Synonyms1300018G05Rik
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17405986-17430827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17428236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 240 (T240K)
Ref Sequence ENSEMBL: ENSMUSP00000023449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023449]
Predicted Effect probably damaging
Transcript: ENSMUST00000023449
AA Change: T240K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765
AA Change: T240K

DomainStartEndE-ValueType
t_SNARE 45 112 1.53e-6 SMART
t_SNARE 193 260 1.39e-13 SMART
Meta Mutation Damage Score 0.1150 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slightly reduced birth body size and a congenital ichtyotic phenotype associated with scaly and tight skin, hyperkeratosis, acanthosis, abnormalities in epidermal differentiation and autophagy, and increased endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Snap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03231:Snap29 APN 16 17427100 missense probably benign 0.06
IGL02799:Snap29 UTSW 16 17422503 missense probably benign
R0371:Snap29 UTSW 16 17406203 missense probably benign 0.02
R0616:Snap29 UTSW 16 17422506 nonsense probably null
R0709:Snap29 UTSW 16 17406148 missense probably damaging 0.99
R2002:Snap29 UTSW 16 17406326 nonsense probably null
R2137:Snap29 UTSW 16 17428249 missense possibly damaging 0.60
R4478:Snap29 UTSW 16 17428155 missense probably benign 0.00
R4976:Snap29 UTSW 16 17419268 missense probably damaging 1.00
R5933:Snap29 UTSW 16 17406330 missense probably damaging 1.00
R6314:Snap29 UTSW 16 17419319 missense probably benign 0.25
R6824:Snap29 UTSW 16 17422506 missense probably benign 0.01
R7397:Snap29 UTSW 16 17419372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACAGTGGCTGTCTAGAGGGAGG -3'
(R):5'- AGTAGTTCTGACACTCTGCCCGTG -3'

Sequencing Primer
(F):5'- GGAGATACACAGTGGTCTCTACC -3'
(R):5'- AGGCTCAAGGTGTTCACAGTTAC -3'
Posted On2013-04-11