Incidental Mutation 'R0086:Map3k13'
ID19914
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Namemitogen-activated protein kinase kinase kinase 13
Synonyms
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21794346-21933439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21914225 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 526 (N526D)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
Predicted Effect probably damaging
Transcript: ENSMUST00000042065
AA Change: N526D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: N526D

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231988
AA Change: N526D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000232240
AA Change: N526D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1884 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21921764 missense probably benign 0.00
IGL01092:Map3k13 APN 16 21928016 missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21892123 missense probably benign
IGL02444:Map3k13 APN 16 21914232 missense probably benign 0.19
IGL02503:Map3k13 APN 16 21908704 missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21905255 missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21892231 missense possibly damaging 0.94
R0124:Map3k13 UTSW 16 21903756 missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21914157 missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21891988 missense probably benign
R0601:Map3k13 UTSW 16 21905249 missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21906524 missense probably benign 0.03
R0918:Map3k13 UTSW 16 21926240 missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21903792 missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21914189 missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21911086 missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21892144 missense probably benign 0.01
R2332:Map3k13 UTSW 16 21898677 splice site probably null
R2361:Map3k13 UTSW 16 21906536 missense probably benign 0.05
R4395:Map3k13 UTSW 16 21898571 missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4506:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4521:Map3k13 UTSW 16 21905775 missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21892002 missense probably benign
R4952:Map3k13 UTSW 16 21911019 missense probably benign 0.15
R5035:Map3k13 UTSW 16 21921671 missense probably benign 0.03
R5327:Map3k13 UTSW 16 21921647 missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21898641 missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21928048 makesense probably null
R5996:Map3k13 UTSW 16 21905245 missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21905183 missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21921777 missense probably benign 0.15
R6620:Map3k13 UTSW 16 21892311 missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21892312 missense probably benign 0.32
R6692:Map3k13 UTSW 16 21905237 missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21922278 missense probably benign 0.10
R6743:Map3k13 UTSW 16 21892423 missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21922263 missense probably benign 0.00
R6965:Map3k13 UTSW 16 21922150 missense probably benign
R7149:Map3k13 UTSW 16 21925437 missense probably benign 0.04
R7174:Map3k13 UTSW 16 21926256 missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21892238 missense probably benign 0.03
R7400:Map3k13 UTSW 16 21922322 missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21921686 missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7876:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R8002:Map3k13 UTSW 16 21905128 missense probably benign 0.05
R8089:Map3k13 UTSW 16 21903817 missense possibly damaging 0.48
Z1176:Map3k13 UTSW 16 21905162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTGTCTAGTTCCACAGCCTC -3'
(R):5'- GTGGTGCTCAGATAAAGTGCCTCAG -3'

Sequencing Primer
(F):5'- AGCCTCCGTCTTCCATCAATC -3'
(R):5'- GTGGTTTCATCTACAGCCCAG -3'
Posted On2013-04-11