Incidental Mutation 'R1730:Kif14'
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission 039762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R1730 (G1)
Quality Score225
Status Not validated
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136503431 bp
Amino Acid Change Leucine to Phenylalanine at position 1189 (L1189F)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
PDB Structure
Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000047817
AA Change: L1139F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: L1139F

KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088648
Predicted Effect probably benign
Transcript: ENSMUST00000189413
AA Change: L1189F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: L1189F

low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 199 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,919,278 I369T possibly damaging Het
Aass T C 6: 23,121,019 D82G probably damaging Het
Abi3bp G A 16: 56,668,279 V1258I possibly damaging Het
Acad11 T A 9: 104,063,882 V41E probably benign Het
Aff1 T G 5: 103,833,512 L514V probably damaging Het
Ankdd1b G T 13: 96,460,903 T7K probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Bag3 A T 7: 128,523,859 M1L possibly damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Carmil1 T C 13: 24,041,689 T635A probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep63 T A 9: 102,618,867 I114F possibly damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cnr1 A G 4: 33,943,851 T80A possibly damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 A C 9: 79,628,378 V2612G possibly damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Cyp2c29 A T 19: 39,324,945 H295L possibly damaging Het
Cyp2c68 A T 19: 39,699,275 M426K possibly damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg2 G A 18: 20,591,880 V448I probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Eogt T C 6: 97,113,864 D438G probably damaging Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Etnppl A G 3: 130,620,749 T98A probably damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam131b T G 6: 42,318,580 Q221P possibly damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gatad2a G T 8: 69,909,936 H600N probably damaging Het
Gba2 A G 4: 43,578,242 C36R probably benign Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm10961 T C 3: 107,632,994 probably benign Het
Gm4847 T C 1: 166,638,339 D227G possibly damaging Het
Gpr37l1 C A 1: 135,161,530 E266* probably null Het
Gucy1a2 A T 9: 3,634,957 N334Y probably benign Het
H2-D1 A G 17: 35,263,405 T34A probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna5 A T 6: 126,533,860 I435N probably damaging Het
Kcnj5 T C 9: 32,322,192 I276V probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Klhl20 A G 1: 161,102,990 V314A possibly damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lin7b A T 7: 45,369,927 H72Q probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Map3k9 A T 12: 81,722,226 V1016E probably damaging Het
Mcam T C 9: 44,134,706 L6P probably damaging Het
Mgam A G 6: 40,664,860 H549R possibly damaging Het
Mrc1 T C 2: 14,327,844 V1285A probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b A G 2: 155,625,672 D739G possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Nfkbib A T 7: 28,762,055 Y86N probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrip1 G T 16: 76,292,890 T593K probably benign Het
Obscn A G 11: 59,073,633 Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfml2b G A 1: 170,681,789 G569S probably damaging Het
Olfr1012 T A 2: 85,760,242 I45F possibly damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1307 T C 2: 111,945,288 H56R probably benign Het
Olfr1417 T A 19: 11,828,081 Q315L probably benign Het
Olfr371 A C 8: 85,230,848 M118L probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr924 T A 9: 38,848,972 I286K probably damaging Het
Olfr951 T C 9: 39,394,222 Y144H probably benign Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T A 18: 80,079,825 F25I probably damaging Het
Parp6 C A 9: 59,633,538 C291* probably null Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Polr2i T C 7: 30,233,068 C67R probably damaging Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgfrn T C 3: 101,056,442 N618S possibly damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Rad17 C T 13: 100,622,806 R571Q probably damaging Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rims1 C T 1: 22,346,529 probably null Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sele T G 1: 164,054,623 V559G probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Setd1a T A 7: 127,785,124 Y382* probably null Het
Sipa1l2 A T 8: 125,480,141 probably null Het
Slc25a41 T C 17: 57,039,921 E10G probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Susd4 A G 1: 182,853,978 E128G probably damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tbc1d17 A C 7: 44,845,131 S227A probably damaging Het
Tfg G T 16: 56,712,789 N2K probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem143 G A 7: 45,907,002 D144N possibly damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trim47 A G 11: 116,106,038 L630P probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttk A G 9: 83,868,592 N691S possibly damaging Het
Ttn T G 2: 76,716,992 T32237P probably damaging Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Uggt1 T C 1: 36,221,261 T158A probably benign Het
Usp9y A T Y: 1,367,093 V998D probably benign Het
Vwa5b2 C T 16: 20,600,925 P644S probably damaging Het
Wars A C 12: 108,875,741 F160C probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp541 A G 7: 16,077,973 T184A probably damaging Het
Zfp804b T C 5: 6,771,938 D375G probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
R7674:Kif14 UTSW 1 136468820 missense probably damaging 0.99
R7688:Kif14 UTSW 1 136494654 missense probably damaging 1.00
R7711:Kif14 UTSW 1 136471453 missense probably benign 0.10
R7722:Kif14 UTSW 1 136468295 missense probably benign 0.00
R7763:Kif14 UTSW 1 136516383 missense probably benign 0.00
R7882:Kif14 UTSW 1 136471576 critical splice donor site probably null
R7882:Kif14 UTSW 1 136516025 missense probably benign 0.43
R7965:Kif14 UTSW 1 136471576 critical splice donor site probably null
R7965:Kif14 UTSW 1 136516025 missense probably benign 0.43
R8077:Kif14 UTSW 1 136471448 missense possibly damaging 0.87
R8101:Kif14 UTSW 1 136476352 missense probably benign 0.14
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Z1176:Kif14 UTSW 1 136496653 missense probably damaging 0.97
Z1176:Kif14 UTSW 1 136500016 critical splice acceptor site probably null
Z1177:Kif14 UTSW 1 136478365 missense probably benign
Predicted Primers PCR Primer
(F):5'- ctctttgccagtaagAGCCCTGTG -3'

Sequencing Primer
(R):5'- acagggtttcatacacaccag -3'
Posted On2014-05-23