Incidental Mutation 'R0086:Abcg8'
ID19918
Institutional Source Beutler Lab
Gene Symbol Abcg8
Ensembl Gene ENSMUSG00000024254
Gene NameATP binding cassette subfamily G member 8
Synonyms1300003C16Rik, Sterolin-2
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84676302-84700333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84692771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000126675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045714] [ENSMUST00000170725] [ENSMUST00000171915]
Predicted Effect probably damaging
Transcript: ENSMUST00000045714
AA Change: V253A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035246
Gene: ENSMUSG00000024254
AA Change: V253A

DomainStartEndE-ValueType
Pfam:ABC_tran 89 242 2.1e-29 PFAM
Pfam:ABC2_membrane 397 608 1.7e-36 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170725
AA Change: V126A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127785
Gene: ENSMUSG00000024254
AA Change: V126A

DomainStartEndE-ValueType
Pfam:ABC_tran 1 115 2.6e-18 PFAM
Pfam:ABC2_membrane 270 481 7.4e-38 PFAM
transmembrane domain 513 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171915
AA Change: V252A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126675
Gene: ENSMUSG00000024254
AA Change: V252A

DomainStartEndE-ValueType
Pfam:ABC_tran 88 241 7.5e-30 PFAM
Pfam:ABC2_membrane 396 607 1.7e-37 PFAM
transmembrane domain 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.7127 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants fail to secrete cholesterol into bile and exhibit increased plasma and tissue plant sterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Abcg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Abcg8 APN 17 84688529 splice site probably null
IGL01019:Abcg8 APN 17 84691995 missense probably benign 0.21
IGL02498:Abcg8 APN 17 84683265 missense probably benign
IGL02506:Abcg8 APN 17 84692488 missense possibly damaging 0.84
IGL03077:Abcg8 APN 17 84691880 missense probably damaging 1.00
R0130:Abcg8 UTSW 17 84686666 missense probably damaging 1.00
R0930:Abcg8 UTSW 17 84683277 missense probably benign 0.00
R1466:Abcg8 UTSW 17 84686727 splice site probably benign
R1493:Abcg8 UTSW 17 84696679 missense probably damaging 1.00
R1628:Abcg8 UTSW 17 84691991 nonsense probably null
R1916:Abcg8 UTSW 17 84688530 critical splice acceptor site probably null
R1935:Abcg8 UTSW 17 84694989 splice site probably benign
R1971:Abcg8 UTSW 17 84695159 splice site probably benign
R4638:Abcg8 UTSW 17 84691941 missense probably damaging 1.00
R4693:Abcg8 UTSW 17 84696697 missense probably damaging 1.00
R5182:Abcg8 UTSW 17 84692744 missense probably damaging 1.00
R5227:Abcg8 UTSW 17 84691821 missense probably damaging 1.00
R5621:Abcg8 UTSW 17 84695993 missense probably damaging 0.96
R5772:Abcg8 UTSW 17 84686699 missense probably damaging 1.00
R7315:Abcg8 UTSW 17 84696714 missense probably damaging 0.99
R7709:Abcg8 UTSW 17 84692491 missense probably damaging 0.99
R8231:Abcg8 UTSW 17 84692785 missense probably damaging 1.00
Z1177:Abcg8 UTSW 17 84692006 missense possibly damaging 0.95
Z1177:Abcg8 UTSW 17 84695030 nonsense probably null
Z1177:Abcg8 UTSW 17 84696118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAAAGAGTTTGTGCAGCCCC -3'
(R):5'- GCCTTTACCACTCACCGTAGAAGTC -3'

Sequencing Primer
(F):5'- TCCTCAGGTGGAAGACGTAATC -3'
(R):5'- TCACCGTAGAAGTCCGCAG -3'
Posted On2013-04-11