Incidental Mutation 'R0087:Tns1'
ID19923
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R0087 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73916917 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 549 (H549L)
Ref Sequence ENSEMBL: ENSMUSP00000139844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169786
AA Change: H1813L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: H1813L

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000187584
AA Change: H1748L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: H1748L

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187691
AA Change: H549L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322
AA Change: H549L

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
SH2 350 452 4.3e-19 SMART
PTB 483 624 9e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191104
AA Change: H1792L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: H1792L

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212888
AA Change: H1805L

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R7570:Tns1 UTSW 1 73953479 missense probably damaging 1.00
R7670:Tns1 UTSW 1 73952477 missense possibly damaging 0.93
R7769:Tns1 UTSW 1 73953371 missense probably damaging 0.99
R7833:Tns1 UTSW 1 74091331 intron probably benign
R8052:Tns1 UTSW 1 73953437 missense probably damaging 1.00
R8225:Tns1 UTSW 1 73985887 missense probably damaging 1.00
R8244:Tns1 UTSW 1 73937251 missense probably damaging 1.00
R8321:Tns1 UTSW 1 73985780 critical splice acceptor site probably null
Z1177:Tns1 UTSW 1 74002307 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AATTGCTCTCACTGCCCAGGACAC -3'
(R):5'- GGCCCGCTTTGAGCATACATAACAC -3'

Sequencing Primer
(F):5'- GGACACACCAAAGCCGTG -3'
(R):5'- tttctctctccctctccctc -3'
Posted On2013-04-11