Incidental Mutation 'R1730:Setd1a'
ID 199235
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 039762-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1730 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 127384296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 382 (Y382*)
Ref Sequence ENSEMBL: ENSMUSP00000037600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect probably null
Transcript: ENSMUST00000047075
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: Y382*

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047157
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: Y382*

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 205 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,896,259 (GRCm39) I369T possibly damaging Het
Aass T C 6: 23,121,018 (GRCm39) D82G probably damaging Het
Abi3bp G A 16: 56,488,642 (GRCm39) V1258I possibly damaging Het
Acad11 T A 9: 103,941,081 (GRCm39) V41E probably benign Het
Aff1 T G 5: 103,981,378 (GRCm39) L514V probably damaging Het
Ankdd1b G T 13: 96,597,411 (GRCm39) T7K probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Bag3 A T 7: 128,125,583 (GRCm39) M1L possibly damaging Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Carmil1 T C 13: 24,225,672 (GRCm39) T635A probably damaging Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cep63 T A 9: 102,496,066 (GRCm39) I114F possibly damaging Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Cnr1 A G 4: 33,943,851 (GRCm39) T80A possibly damaging Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Col12a1 A C 9: 79,535,660 (GRCm39) V2612G possibly damaging Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Cyp2c29 A T 19: 39,313,389 (GRCm39) H295L possibly damaging Het
Cyp2c68 A T 19: 39,687,719 (GRCm39) M426K possibly damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsg2 G A 18: 20,724,937 (GRCm39) V448I probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
En1 A G 1: 120,531,350 (GRCm39) S197G unknown Het
Eogt T C 6: 97,090,825 (GRCm39) D438G probably damaging Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Etnppl A G 3: 130,414,398 (GRCm39) T98A probably damaging Het
Eya2 G T 2: 165,529,583 (GRCm39) G109W probably damaging Het
Fam131b T G 6: 42,295,514 (GRCm39) Q221P possibly damaging Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gatad2a G T 8: 70,362,586 (GRCm39) H600N probably damaging Het
Gba2 A G 4: 43,578,242 (GRCm39) C36R probably benign Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Gm10961 T C 3: 107,540,310 (GRCm39) probably benign Het
Gm4847 T C 1: 166,465,908 (GRCm39) D227G possibly damaging Het
Gpr37l1 C A 1: 135,089,268 (GRCm39) E266* probably null Het
Gucy1a2 A T 9: 3,634,957 (GRCm39) N334Y probably benign Het
H2-D1 A G 17: 35,482,381 (GRCm39) T34A probably damaging Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcna5 A T 6: 126,510,823 (GRCm39) I435N probably damaging Het
Kcnj5 T C 9: 32,233,488 (GRCm39) I276V probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Klhl20 A G 1: 160,930,560 (GRCm39) V314A possibly damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lin7b A T 7: 45,019,351 (GRCm39) H72Q probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Map3k9 A T 12: 81,769,000 (GRCm39) V1016E probably damaging Het
Mcam T C 9: 44,046,003 (GRCm39) L6P probably damaging Het
Mgam A G 6: 40,641,794 (GRCm39) H549R possibly damaging Het
Mrc1 T C 2: 14,332,655 (GRCm39) V1285A probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Myh7b A G 2: 155,467,592 (GRCm39) D739G possibly damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Nfkbib A T 7: 28,461,480 (GRCm39) Y86N probably damaging Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrip1 G T 16: 76,089,778 (GRCm39) T593K probably benign Het
Obscn A G 11: 58,964,459 (GRCm39) Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Olfml2b G A 1: 170,509,358 (GRCm39) G569S probably damaging Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or10v5 T A 19: 11,805,445 (GRCm39) Q315L probably benign Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or4f14b T C 2: 111,775,633 (GRCm39) H56R probably benign Het
Or7c19 A C 8: 85,957,477 (GRCm39) M118L probably benign Het
Or8d2 T A 9: 38,760,268 (GRCm39) I286K probably damaging Het
Or8g32 T C 9: 39,305,518 (GRCm39) Y144H probably benign Het
Or9g3 T A 2: 85,590,586 (GRCm39) I45F possibly damaging Het
Pard6g T A 18: 80,123,040 (GRCm39) F25I probably damaging Het
Parp6 C A 9: 59,540,821 (GRCm39) C291* probably null Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Polr2i T C 7: 29,932,493 (GRCm39) C67R probably damaging Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptgfrn T C 3: 100,963,758 (GRCm39) N618S possibly damaging Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rad17 C T 13: 100,759,314 (GRCm39) R571Q probably damaging Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 A C 1: 133,284,195 (GRCm39) K187Q probably benign Het
Rims1 C T 1: 22,416,753 (GRCm39) probably null Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sele T G 1: 163,882,192 (GRCm39) V559G probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Sipa1l2 A T 8: 126,206,880 (GRCm39) probably null Het
Slc25a41 T C 17: 57,346,921 (GRCm39) E10G probably benign Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc36a1 A G 11: 55,114,498 (GRCm39) D192G probably damaging Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Susd4 A G 1: 182,681,543 (GRCm39) E128G probably damaging Het
Synpo2l G A 14: 20,715,887 (GRCm39) P233S probably damaging Het
Tbc1d17 A C 7: 44,494,555 (GRCm39) S227A probably damaging Het
Tfg G T 16: 56,533,152 (GRCm39) N2K probably damaging Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tmem143 G A 7: 45,556,426 (GRCm39) D144N possibly damaging Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Trim47 A G 11: 115,996,864 (GRCm39) L630P probably damaging Het
Ttk A G 9: 83,750,645 (GRCm39) N691S possibly damaging Het
Ttn T G 2: 76,547,336 (GRCm39) T32237P probably damaging Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Uggt1 T C 1: 36,260,342 (GRCm39) T158A probably benign Het
Usp9y A T Y: 1,367,093 (GRCm39) V998D probably benign Het
Vwa5b2 C T 16: 20,419,675 (GRCm39) P644S probably damaging Het
Wars1 A C 12: 108,841,667 (GRCm39) F160C probably damaging Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zfp541 A G 7: 15,811,898 (GRCm39) T184A probably damaging Het
Zfp804b T C 5: 6,821,938 (GRCm39) D375G probably damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTCACATAGGTAGGAGCCTAGC -3'
(R):5'- TCCTTCAGCAGCATTTCAATACGGG -3'

Sequencing Primer
(F):5'- CATAGGTAGGAGCCTAGCTAACTC -3'
(R):5'- caccaccaccaccactac -3'
Posted On 2014-05-23