Incidental Mutation 'R0087:Inpp5d'
ID19924
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0087 (G1)
Quality Score166
Status Validated (trace)
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87715138 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 672 (S672P)
Ref Sequence ENSEMBL: ENSMUSP00000126569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably benign
Transcript: ENSMUST00000042275
AA Change: S934P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: S934P

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163548
Predicted Effect probably damaging
Transcript: ENSMUST00000167032
AA Change: S672P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: S672P

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168783
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169754
AA Change: S935P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: S935P

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170300
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
new_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGCAGACAGCCTTGAGTCAATC -3'
(R):5'- CAATTCAGAGGACACTCACCTTGCC -3'

Sequencing Primer
(F):5'- AGACAGCCTTGAGTCAATCTTCTC -3'
(R):5'- GACACTCACCTTGCCTCTTG -3'
Posted On2013-04-11