Mutagenetix > Incidental Mutation

Incidental Mutation 'R0087:Elf3'

19927

Institutional Source

Beutler Lab

Gene Symbol

Elf3

Ensembl Gene

ENSMUSG00000003051

Gene Name

E74-like factor 3

Synonyms

ESX, jen, ESE-1

MMRRC Submission

038374-MU

Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R0087 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

135253575-135258568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135257137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 104 (Y104H)

Ref Sequence

ENSEMBL: ENSMUSP00000003135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]

AlphaFold

Q3UPW2

PDB Structure

Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003135
AA Change: Y104H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: Y104H

Domain	Start	End	E-Value	Type
SAM_PNT	67	151	6.32e-30	SMART
low complexity region	230	241	N/A	INTRINSIC
AT_hook	264	276	1.29e0	SMART
ETS	292	379	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180981

Predicted Effect

probably damaging
Transcript: ENSMUST00000185752
AA Change: Y84H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: Y84H

Domain	Start	End	E-Value	Type
SAM_PNT	47	131	1.36e-29	SMART
low complexity region	210	221	N/A	INTRINSIC
AT_hook	244	256	1.29e0	SMART
ETS	272	359	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188895

Meta Mutation Damage Score

0.4853

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 93.5%
20x: 82.3%

Validation Efficiency

86% (59/69)

MGI Phenotype

Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	T	A	19: 53,226,607	L71Q	probably damaging	Het
Adgrv1	T	A	13: 81,386,951	I5732F	probably damaging	Het
Adss	A	T	1: 177,771,222	V330E	probably benign	Het
Agps	T	A	2: 75,909,635	Y488N	probably damaging	Het
Ap3s1	A	T	18: 46,758,039	R66S	probably damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp2a2	C	T	5: 122,460,961	V593I	probably benign	Het
Chrna6	C	T	8: 27,406,986	V288M	probably damaging	Het
Col4a2	C	T	8: 11,441,296	L1232F	probably benign	Het
Dcaf1	A	G	9: 106,863,089	N1225D	probably damaging	Het
Degs1	A	G	1: 182,279,310	I128T	probably benign	Het
Dnah5	A	T	15: 28,350,613	T2594S	probably damaging	Het
Dnah8	G	T	17: 30,755,119	R2826L	probably damaging	Het
Fam222b	C	A	11: 78,153,892	T93N	probably benign	Het
Fbxw26	A	G	9: 109,724,938	I211T	probably benign	Het
Fcho2	T	C	13: 98,735,086	T541A	probably benign	Het
Flg2	T	C	3: 93,202,431	S589P	unknown	Het
Foxj3	T	A	4: 119,626,400	V589E	unknown	Het
Gria1	A	G	11: 57,317,712	Y742C	probably damaging	Het
Inpp5d	T	C	1: 87,715,138	S672P	probably damaging	Het
Lrrc19	A	C	4: 94,640,772	F91C	probably damaging	Het
Lrrc6	T	C	15: 66,469,975	T91A	probably benign	Het
Mppe1	A	G	18: 67,225,704	*398R	probably null	Het
Mroh3	T	C	1: 136,190,803	I561V	probably benign	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Nbea	G	T	3: 56,091,023	T121K	possibly damaging	Het
Nbr1	A	C	11: 101,564,693	D91A	probably benign	Het
Ncam2	C	A	16: 81,434,901	N84K	probably benign	Het
Olfr1260	T	C	2: 89,978,131	Y118H	probably damaging	Het
Olfr616	A	T	7: 103,564,362	C306S	probably benign	Het
Olfr618	A	G	7: 103,597,721	Y135C	probably benign	Het
Olfr651	A	G	7: 104,553,662	I248V	possibly damaging	Het
Olfr711	A	G	7: 106,972,116	V76A	probably benign	Het
Pdgfrb	A	T	18: 61,061,513	I121F	probably damaging	Het
Peak1	A	T	9: 56,258,325	I773N	probably damaging	Het
Pfkfb4	G	T	9: 109,007,701	V155F	probably damaging	Het
Pkm	C	T	9: 59,678,099	R455*	probably null	Het
Plbd2	C	A	5: 120,494,485	E151*	probably null	Het
Pld5	G	A	1: 175,984,459	T353M	probably damaging	Het
Psme2b	A	T	11: 48,945,717	D134E	possibly damaging	Het
Rida	T	A	15: 34,488,626	D40V	possibly damaging	Het
Rnf126	A	T	10: 79,759,234	H265Q	probably damaging	Het
Rock2	C	A	12: 16,928,966	Q86K	probably benign	Het
Serpinb1b	A	T	13: 33,085,319	T12S	probably benign	Het
Slco6c1	T	A	1: 97,118,578	Q277L	probably benign	Het
Sptlc2	T	A	12: 87,369,118	H45L	probably benign	Het
Srsf4	A	G	4: 131,900,330		probably benign	Het
Sspo	A	G	6: 48,477,785	S2969G	probably damaging	Het
Steap1	C	T	5: 5,736,664	G258R	probably damaging	Het
Stk19	A	T	17: 34,836,875	M1K	probably null	Het
Stk-ps2	C	A	1: 46,029,889		noncoding transcript	Het
Taf1c	C	T	8: 119,600,987	R332H	probably damaging	Het
Thbs4	T	A	13: 92,755,235	T791S	probably damaging	Het
Theg	A	T	10: 79,585,951	Y144*	probably null	Het
Tjap1	A	G	17: 46,263,726	L21P	probably damaging	Het
Tmem145	A	G	7: 25,307,843	Y148C	probably damaging	Het
Tmem267	T	A	13: 119,609,274	V155E	probably benign	Het
Tns1	T	A	1: 73,916,917	H549L	possibly damaging	Het
Tyro3	T	G	2: 119,801,701	I83S	probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn1r53	A	T	6: 90,223,431	C304S	probably benign	Het
Vwf	G	A	6: 125,645,954	M1761I	probably benign	Het
Zfp276	T	C	8: 123,265,047	Y445H	probably damaging	Het
Zfp407	A	T	18: 84,560,411	I859N	probably damaging	Het

Other mutations in Elf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02141:Elf3	APN	1	135257707	missense	possibly damaging	0.94
IGL02470:Elf3	APN	1	135255012	missense	probably damaging	1.00
IGL03018:Elf3	APN	1	135256065	missense	possibly damaging	0.62
IGL03252:Elf3	APN	1	135254953	missense	probably damaging	1.00
P0026:Elf3	UTSW	1	135255973	critical splice donor site	probably null
R1842:Elf3	UTSW	1	135256793	missense	possibly damaging	0.65
R1897:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R2081:Elf3	UTSW	1	135257076	missense	probably benign	0.12
R4049:Elf3	UTSW	1	135254277	missense	probably benign	0.21
R4467:Elf3	UTSW	1	135256844	missense	probably damaging	1.00
R4630:Elf3	UTSW	1	135256740	intron	probably benign
R4715:Elf3	UTSW	1	135257752	missense	probably damaging	1.00
R4923:Elf3	UTSW	1	135256735	intron	probably benign
R5226:Elf3	UTSW	1	135257239	missense	probably benign	0.07
R5422:Elf3	UTSW	1	135255040	missense	probably damaging	0.98
R5706:Elf3	UTSW	1	135256482	missense	probably benign	0.01
R7115:Elf3	UTSW	1	135257118	missense	probably damaging	1.00
R7644:Elf3	UTSW	1	135256506	missense	possibly damaging	0.89
R7855:Elf3	UTSW	1	135254352	missense	probably damaging	1.00
R7940:Elf3	UTSW	1	135257128	missense	probably damaging	1.00
R8315:Elf3	UTSW	1	135256576	missense	probably benign	0.00
R8723:Elf3	UTSW	1	135257647	missense	possibly damaging	0.95
R8724:Elf3	UTSW	1	135254360	missense	probably damaging	1.00
R8906:Elf3	UTSW	1	135254940	missense	probably damaging	1.00
R8960:Elf3	UTSW	1	135255075	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTCCAGCAGCTCGATGATCCAG -3'
(R):5'- TGTGTAGGACCTCAGACAAGATCCC -3'

Sequencing Primer
(F):5'- TTCATCAGAAGAGTTGGAGGCTG -3'
(R):5'- CAAAGGGACAGGACTGATCCTC -3'

Posted On

2013-04-11