Mutagenetix > Incidental Mutation

Incidental Mutation 'R1731:Rusc2'

199294

Institutional Source

Beutler Lab

Gene Symbol

Rusc2

Ensembl Gene

ENSMUSG00000035969

Gene Name

RUN and SH3 domain containing 2

Synonyms

MMRRC Submission

039763-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R1731 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43381979-43427088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43426046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1384 (A1384S)

Ref Sequence

ENSEMBL: ENSMUSP00000118528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000173682] [ENSMUST00000171134]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035645
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: A1384S

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052829

SMART Domains

Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	47	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098106
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: A1384S

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107928

SMART Domains

Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	1.3e-20	PFAM
Pfam:DUF2475	212	251	6.9e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107929

SMART Domains

Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	1.5e-20	PFAM
Pfam:DUF2475	232	271	7.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125393

Predicted Effect

probably benign
Transcript: ENSMUST00000131668
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: A1384S

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146710

Predicted Effect

probably benign
Transcript: ENSMUST00000149221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149556

Predicted Effect

probably benign
Transcript: ENSMUST00000149676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154754

Predicted Effect

probably benign
Transcript: ENSMUST00000173682

SMART Domains

Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	685	703	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171134

SMART Domains

Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	7.2e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155080

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam7	T	A	14: 68,525,356	Y140F	probably damaging	Het
Adgrl4	T	G	3: 151,540,986	I641S	possibly damaging	Het
Aqp9	A	G	9: 71,122,968	I205T	possibly damaging	Het
Arap3	C	T	18: 37,989,912	V512I	probably benign	Het
Atf2	C	T	2: 73,845,509	G123E	probably damaging	Het
Baz1a	T	C	12: 54,918,545	D708G	possibly damaging	Het
Calcrl	A	G	2: 84,345,168		probably null	Het
Capzb	T	A	4: 139,280,030	W110R	probably damaging	Het
Casp8ap2	A	T	4: 32,641,442	N832I	possibly damaging	Het
Cecr2	T	A	6: 120,758,180	H764Q	possibly damaging	Het
Cep131	T	C	11: 120,076,916		probably null	Het
Ces2e	T	C	8: 104,929,576	V173A	probably damaging	Het
Clstn3	T	C	6: 124,431,632	D944G	probably benign	Het
Cyb5rl	C	A	4: 107,080,913	A189E	probably damaging	Het
Cyp2c40	A	G	19: 39,812,689	S41P	probably damaging	Het
D3Ertd254e	T	A	3: 36,164,471	F214L	probably benign	Het
Dscam	A	G	16: 96,819,876	L544P	probably damaging	Het
Epha2	A	G	4: 141,321,752	K640E	possibly damaging	Het
Erap1	T	A	13: 74,666,122	C8*	probably null	Het
Fat3	A	G	9: 15,995,937	V2923A	probably benign	Het
Fat4	A	T	3: 38,891,310	I1451F	probably damaging	Het
Fuk	A	T	8: 110,894,823	I163N	probably damaging	Het
Fzd6	G	A	15: 39,031,327	G296D	probably damaging	Het
Gm3486	T	A	14: 41,484,535	M194L	probably benign	Het
Gm5592	C	T	7: 41,288,413	A373V	probably damaging	Het
Gm5861	T	A	5: 11,183,113	N14K	probably damaging	Het
Hectd3	T	A	4: 116,996,455		probably null	Het
Hira	T	A	16: 18,933,014	V521E	probably benign	Het
Hsd17b6	A	G	10: 127,994,479	L141S	possibly damaging	Het
Idua	A	G	5: 108,681,672	D467G	probably benign	Het
Ikzf4	G	A	10: 128,634,532	P373L	probably benign	Het
Kcng1	T	C	2: 168,268,689	E185G	probably benign	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lpcat4	T	C	2: 112,243,843	L250P	probably damaging	Het
Lrrc49	A	G	9: 60,621,631	Y281H	probably damaging	Het
Mta2	C	A	19: 8,947,724		probably null	Het
Myo15b	T	C	11: 115,891,560	I372T	possibly damaging	Het
Myocd	T	A	11: 65,200,888	N76I	probably benign	Het
Nav2	T	A	7: 49,548,174	Y1123N	probably damaging	Het
Otogl	A	T	10: 107,817,111	C1127S	probably damaging	Het
Pcdhb8	A	G	18: 37,355,838	K190E	probably damaging	Het
Pcnx	A	G	12: 81,990,704	H1918R	probably damaging	Het
Pde2a	T	A	7: 101,501,660	Y272N	probably damaging	Het
Phldb3	T	C	7: 24,619,235	V313A	probably benign	Het
Plch2	C	T	4: 155,006,994	V116I	possibly damaging	Het
Plod2	G	A	9: 92,584,604		probably null	Het
Ppfibp2	T	C	7: 107,740,589	Y730H	probably damaging	Het
Ptprh	T	C	7: 4,601,913	E44G	probably benign	Het
Rab11fip1	T	C	8: 27,152,410	E787G	probably damaging	Het
Rabep2	T	A	7: 126,444,272	L448Q	probably damaging	Het
Rbfox3	A	G	11: 118,496,936		probably null	Het
Rgma	T	C	7: 73,409,412	V88A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf125	A	G	18: 20,977,816	T44A	probably benign	Het
Selp	T	A	1: 164,141,440	C536*	probably null	Het
Serpinb3c	G	A	1: 107,271,774	T339I	probably damaging	Het
Slc4a5	C	T	6: 83,296,635	R986C	probably damaging	Het
Slc8b1	T	C	5: 120,521,115	I208T	probably benign	Het
Sp3	G	A	2: 72,946,655	H533Y	probably damaging	Het
Tiam2	A	G	17: 3,518,423	R1615G	probably damaging	Het
Tie1	T	C	4: 118,476,263	E802G	probably damaging	Het
Tinagl1	A	G	4: 130,168,049	V164A	probably benign	Het
Vmn1r68	A	G	7: 10,527,875	Y99H	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r56	T	C	7: 12,733,045	T21A	probably benign	Het
Zfp108	C	A	7: 24,258,539	H34Q	possibly damaging	Het
Zfp456	C	T	13: 67,366,555	S344N	probably benign	Het
Zscan22	T	C	7: 12,906,980	C384R	probably damaging	Het

Other mutations in Rusc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Rusc2	APN	4	43426116	missense	probably damaging	0.97
IGL01474:Rusc2	APN	4	43416434	missense	probably damaging	0.98
IGL01541:Rusc2	APN	4	43415840	missense	probably benign	0.08
IGL01628:Rusc2	APN	4	43425729	missense	probably damaging	1.00
IGL01969:Rusc2	APN	4	43415738	missense	probably benign	0.02
IGL02030:Rusc2	APN	4	43416095	missense	possibly damaging	0.86
IGL02079:Rusc2	APN	4	43425668	missense	probably benign
IGL02115:Rusc2	APN	4	43426136	splice site	probably benign
IGL02122:Rusc2	APN	4	43421685	missense	possibly damaging	0.67
IGL02350:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02357:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02437:Rusc2	APN	4	43415545	missense	probably damaging	1.00
IGL02930:Rusc2	APN	4	43416376	missense	probably damaging	0.99
IGL03154:Rusc2	APN	4	43425806	missense	probably benign	0.00
P0026:Rusc2	UTSW	4	43415840	missense	possibly damaging	0.93
R0036:Rusc2	UTSW	4	43424009	missense	probably damaging	1.00
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0114:Rusc2	UTSW	4	43422055	missense	probably damaging	1.00
R0255:Rusc2	UTSW	4	43423954	missense	probably damaging	1.00
R0471:Rusc2	UTSW	4	43425486	missense	probably damaging	0.99
R1381:Rusc2	UTSW	4	43416137	missense	probably damaging	1.00
R1413:Rusc2	UTSW	4	43416568	missense	probably benign	0.00
R1416:Rusc2	UTSW	4	43421617	missense	possibly damaging	0.86
R1864:Rusc2	UTSW	4	43421719	missense	possibly damaging	0.49
R1897:Rusc2	UTSW	4	43421749	missense	probably damaging	1.00
R2010:Rusc2	UTSW	4	43415212	missense	probably benign	0.06
R2212:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R2275:Rusc2	UTSW	4	43416260	missense	probably damaging	1.00
R2885:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R2886:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R3412:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3413:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3414:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3852:Rusc2	UTSW	4	43416424	missense	probably benign	0.45
R4135:Rusc2	UTSW	4	43425563	missense	possibly damaging	0.49
R4272:Rusc2	UTSW	4	43415533	missense	probably damaging	1.00
R4574:Rusc2	UTSW	4	43416080	missense	probably damaging	0.99
R4888:Rusc2	UTSW	4	43423942	missense	probably damaging	1.00
R5010:Rusc2	UTSW	4	43415926	missense	probably damaging	1.00
R5071:Rusc2	UTSW	4	43415240	missense	probably benign	0.05
R5131:Rusc2	UTSW	4	43414948	missense	probably benign	0.03
R5177:Rusc2	UTSW	4	43421805	splice site	probably null
R5540:Rusc2	UTSW	4	43423975	missense	probably damaging	1.00
R5561:Rusc2	UTSW	4	43415932	nonsense	probably null
R5628:Rusc2	UTSW	4	43425348	missense	probably damaging	1.00
R5645:Rusc2	UTSW	4	43425758	missense	probably benign	0.06
R6129:Rusc2	UTSW	4	43424271	missense	probably damaging	1.00
R6362:Rusc2	UTSW	4	43416416	missense	probably benign	0.30
R6633:Rusc2	UTSW	4	43414852	missense	probably damaging	0.99
R6980:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R7491:Rusc2	UTSW	4	43426528	missense	probably damaging	1.00
R7641:Rusc2	UTSW	4	43425335	missense	possibly damaging	0.84
R7698:Rusc2	UTSW	4	43414900	nonsense	probably null
R7710:Rusc2	UTSW	4	43416119	missense	probably benign	0.07
R8052:Rusc2	UTSW	4	43421851	missense	probably benign
R8061:Rusc2	UTSW	4	43422492	missense	probably damaging	1.00
R8127:Rusc2	UTSW	4	43423747	missense	possibly damaging	0.54
R8319:Rusc2	UTSW	4	43425378	missense	probably damaging	1.00
R8355:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8397:Rusc2	UTSW	4	43424206	missense	possibly damaging	0.95
R8455:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8553:Rusc2	UTSW	4	43416508	missense	probably benign	0.05
R8725:Rusc2	UTSW	4	43401351	intron	probably benign
R8725:Rusc2	UTSW	4	43415396	missense	probably damaging	0.99
R8727:Rusc2	UTSW	4	43401351	intron	probably benign
R8834:Rusc2	UTSW	4	43416431	missense	possibly damaging	0.94
R9295:Rusc2	UTSW	4	43416382	missense	probably damaging	0.98
R9483:Rusc2	UTSW	4	43415897	missense	probably damaging	0.97
X0025:Rusc2	UTSW	4	43422226	missense	probably benign	0.00
X0066:Rusc2	UTSW	4	43422204	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAAGGAACTGCTGCGTGTGTC -3'
(R):5'- ACAGATCCTGGTTCTGCCTGTGTC -3'

Sequencing Primer
(F):5'- agcagcagcagcagtgg -3'
(R):5'- TGTCCTGATTTAGACCAGGC -3'

Posted On

2014-05-23