Incidental Mutation 'R1731:Rusc2'
ID199294
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43426046 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1384 (A1384S)
Ref Sequence ENSEMBL: ENSMUSP00000118528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect probably benign
Transcript: ENSMUST00000035645
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: A1384S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098106
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: A1384S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: A1384S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: A1384S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154754
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 unclassified probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGAACTGCTGCGTGTGTC -3'
(R):5'- ACAGATCCTGGTTCTGCCTGTGTC -3'

Sequencing Primer
(F):5'- agcagcagcagcagtgg -3'
(R):5'- TGTCCTGATTTAGACCAGGC -3'
Posted On2014-05-23