Incidental Mutation 'R1731:Tinagl1'
ID199298
Institutional Source Beutler Lab
Gene Symbol Tinagl1
Ensembl Gene ENSMUSG00000028776
Gene Nametubulointerstitial nephritis antigen-like 1
Synonyms1110021J17Rik, Lcn7, Arg1, androgen-regulated gene 1, AZ-1
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1731 (G1)
Quality Score103
Status Not validated
Chromosome4
Chromosomal Location130164454-130175122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130168049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000134900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030560] [ENSMUST00000105998] [ENSMUST00000105999] [ENSMUST00000132545] [ENSMUST00000175992]
Predicted Effect probably benign
Transcript: ENSMUST00000030560
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030560
Gene: ENSMUSG00000028776
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105998
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101620
Gene: ENSMUSG00000028776
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105999
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101621
Gene: ENSMUSG00000028776
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132545
SMART Domains Protein: ENSMUSP00000135453
Gene: ENSMUSG00000028776

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175822
Predicted Effect probably benign
Transcript: ENSMUST00000175992
AA Change: V164A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134900
Gene: ENSMUSG00000028776
AA Change: V164A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 171 424 2.62e-62 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to tubulointerstitial nephritis antigen, a secreted glycoprotein that is recognized by antibodies in some types of immune-related tubulointerstitial nephritis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Female mice homozygous for a null mutation display impaired fertility and homozygous pups born to homozygous females show impaired postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Tinagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Tinagl1 APN 4 130167430 missense probably damaging 1.00
IGL01935:Tinagl1 APN 4 130168001 missense probably damaging 1.00
R0125:Tinagl1 UTSW 4 130166308 missense probably damaging 1.00
R0893:Tinagl1 UTSW 4 130174023 missense probably damaging 1.00
R2020:Tinagl1 UTSW 4 130166972 missense probably damaging 1.00
R2264:Tinagl1 UTSW 4 130167433 missense probably benign 0.00
R2281:Tinagl1 UTSW 4 130166993 missense probably damaging 1.00
R4786:Tinagl1 UTSW 4 130173931 missense probably benign 0.21
R5058:Tinagl1 UTSW 4 130167457 missense probably benign
R5908:Tinagl1 UTSW 4 130172970 nonsense probably null
R6247:Tinagl1 UTSW 4 130172932 missense probably null 1.00
R6608:Tinagl1 UTSW 4 130172989 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATGGGTGTCATGTGTCCCAAAG -3'
(R):5'- CCCTGAACAGGGCTGATTATTCCAC -3'

Sequencing Primer
(F):5'- TGTCATGTGTCCCAAAGAATGG -3'
(R):5'- CAGGGCTGATTATTCCACTCAAG -3'
Posted On2014-05-23