Incidental Mutation 'R1731:Nav2'
ID199316
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R1731 (G1)
Quality Score141
Status Not validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49548174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1123 (Y1123N)
Ref Sequence ENSEMBL: ENSMUSP00000139309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
Predicted Effect probably damaging
Transcript: ENSMUST00000064395
AA Change: Y1184N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: Y1184N

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183659
AA Change: Y1123N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: Y1123N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184109
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184945
AA Change: Y1184N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: Y1184N

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7451:Nav2 UTSW 7 49552829 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
R7812:Nav2 UTSW 7 49597173 missense probably benign 0.13
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49452761 missense not run
Z1177:Nav2 UTSW 7 49594223 missense not run
Predicted Primers PCR Primer
(F):5'- TAAACACAGTAGCCAGCAGCGTCAG -3'
(R):5'- GAAGAGATGCCTTTCTCCTTGTCCG -3'

Sequencing Primer
(F):5'- TCAATGCCAACAGCTTTGGG -3'
(R):5'- TCTGGTTGACAAGCCCTG -3'
Posted On2014-05-23