Incidental Mutation 'R1731:Fuk'
ID199323
Institutional Source Beutler Lab
Gene Symbol Fuk
Ensembl Gene ENSMUSG00000033703
Gene Namefucokinase
SynonymsL-fucose kinase, 1110046B12Rik
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110882456-110902488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110894823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 163 (I163N)
Ref Sequence ENSEMBL: ENSMUSP00000148787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041382
AA Change: I163N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: I163N

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212568
Predicted Effect probably damaging
Transcript: ENSMUST00000212971
AA Change: I163N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Fuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Fuk APN 8 110890476 missense possibly damaging 0.75
IGL01963:Fuk APN 8 110893402 missense probably damaging 1.00
IGL01986:Fuk APN 8 110883257 missense probably benign
PIT4283001:Fuk UTSW 8 110887432 missense probably benign 0.05
R0008:Fuk UTSW 8 110884233 splice site probably benign
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0280:Fuk UTSW 8 110894748 missense probably damaging 1.00
R0285:Fuk UTSW 8 110893717 missense probably benign 0.08
R0359:Fuk UTSW 8 110893259 intron probably null
R0587:Fuk UTSW 8 110883325 missense probably damaging 0.98
R1528:Fuk UTSW 8 110883241 missense probably damaging 1.00
R1907:Fuk UTSW 8 110893378 nonsense probably null
R2152:Fuk UTSW 8 110889072 missense probably benign 0.03
R2154:Fuk UTSW 8 110889072 missense probably benign 0.03
R2392:Fuk UTSW 8 110889724 missense probably benign
R3037:Fuk UTSW 8 110894718 splice site probably null
R3714:Fuk UTSW 8 110887259 missense probably damaging 1.00
R3765:Fuk UTSW 8 110887104 missense probably benign 0.00
R4307:Fuk UTSW 8 110892080 nonsense probably null
R4404:Fuk UTSW 8 110890301 missense probably benign 0.03
R4768:Fuk UTSW 8 110892134 missense probably benign 0.00
R4998:Fuk UTSW 8 110887803 missense probably damaging 0.96
R5009:Fuk UTSW 8 110887830 missense probably damaging 0.99
R5253:Fuk UTSW 8 110883867 missense possibly damaging 0.90
R6257:Fuk UTSW 8 110890545 missense probably benign 0.00
R6430:Fuk UTSW 8 110884116 missense probably benign 0.16
R6536:Fuk UTSW 8 110883879 missense possibly damaging 0.47
R6599:Fuk UTSW 8 110893283 splice site probably null
R6799:Fuk UTSW 8 110893418 missense probably benign
R7051:Fuk UTSW 8 110890339 missense probably damaging 0.97
R7184:Fuk UTSW 8 110887156 missense probably damaging 1.00
R7241:Fuk UTSW 8 110895897 missense probably benign
R7448:Fuk UTSW 8 110890331 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TATCAAGAACCGCAGGTCCCAGAG -3'
(R):5'- CCATTGGTCTGTTGAGCCTCAGTC -3'

Sequencing Primer
(F):5'- AGGTCCCAGAGCACAGG -3'
(R):5'- gggagggcaagcagcag -3'
Posted On2014-05-23