Mutagenetix > Incidental Mutations

Incidental Mutation 'R1731:Fuk'

199323

Institutional Source

Beutler Lab

Gene Symbol

Fuk

Ensembl Gene

ENSMUSG00000033703

Gene Name

fucokinase

Synonyms

L-fucose kinase, 1110046B12Rik

MMRRC Submission

039763-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R1731 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110882456-110902488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110894823 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 163 (I163N)

Ref Sequence

ENSEMBL: ENSMUSP00000148787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041382
AA Change: I163N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: I163N

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
Pfam:Fucokinase	94	496	1.7e-101	PFAM
low complexity region	807	821	N/A	INTRINSIC
Pfam:GHMP_kinases_N	827	894	3.6e-9	PFAM
Pfam:GHMP_kinases_C	970	1052	1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212242

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212568

Predicted Effect

probably damaging
Transcript: ENSMUST00000212971
AA Change: I163N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam7	T	A	14: 68,525,356	Y140F	probably damaging	Het
Adgrl4	T	G	3: 151,540,986	I641S	possibly damaging	Het
Aqp9	A	G	9: 71,122,968	I205T	possibly damaging	Het
Arap3	C	T	18: 37,989,912	V512I	probably benign	Het
Atf2	C	T	2: 73,845,509	G123E	probably damaging	Het
Baz1a	T	C	12: 54,918,545	D708G	possibly damaging	Het
Calcrl	A	G	2: 84,345,168		probably null	Het
Capzb	T	A	4: 139,280,030	W110R	probably damaging	Het
Casp8ap2	A	T	4: 32,641,442	N832I	possibly damaging	Het
Cecr2	T	A	6: 120,758,180	H764Q	possibly damaging	Het
Cep131	T	C	11: 120,076,916		probably null	Het
Ces2e	T	C	8: 104,929,576	V173A	probably damaging	Het
Clstn3	T	C	6: 124,431,632	D944G	probably benign	Het
Cyb5rl	C	A	4: 107,080,913	A189E	probably damaging	Het
Cyp2c40	A	G	19: 39,812,689	S41P	probably damaging	Het
D3Ertd254e	T	A	3: 36,164,471	F214L	probably benign	Het
Dscam	A	G	16: 96,819,876	L544P	probably damaging	Het
Epha2	A	G	4: 141,321,752	K640E	possibly damaging	Het
Erap1	T	A	13: 74,666,122	C8*	probably null	Het
Fat3	A	G	9: 15,995,937	V2923A	probably benign	Het
Fat4	A	T	3: 38,891,310	I1451F	probably damaging	Het
Fzd6	G	A	15: 39,031,327	G296D	probably damaging	Het
Gm3486	T	A	14: 41,484,535	M194L	probably benign	Het
Gm5592	C	T	7: 41,288,413	A373V	probably damaging	Het
Gm5861	T	A	5: 11,183,113	N14K	probably damaging	Het
Hectd3	T	A	4: 116,996,455		probably null	Het
Hira	T	A	16: 18,933,014	V521E	probably benign	Het
Hsd17b6	A	G	10: 127,994,479	L141S	possibly damaging	Het
Idua	A	G	5: 108,681,672	D467G	probably benign	Het
Ikzf4	G	A	10: 128,634,532	P373L	probably benign	Het
Kcng1	T	C	2: 168,268,689	E185G	probably benign	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lpcat4	T	C	2: 112,243,843	L250P	probably damaging	Het
Lrrc49	A	G	9: 60,621,631	Y281H	probably damaging	Het
Mta2	C	A	19: 8,947,724		probably null	Het
Myo15b	T	C	11: 115,891,560	I372T	possibly damaging	Het
Myocd	T	A	11: 65,200,888	N76I	probably benign	Het
Nav2	T	A	7: 49,548,174	Y1123N	probably damaging	Het
Otogl	A	T	10: 107,817,111	C1127S	probably damaging	Het
Pcdhb8	A	G	18: 37,355,838	K190E	probably damaging	Het
Pcnx	A	G	12: 81,990,704	H1918R	probably damaging	Het
Pde2a	T	A	7: 101,501,660	Y272N	probably damaging	Het
Phldb3	T	C	7: 24,619,235	V313A	probably benign	Het
Plch2	C	T	4: 155,006,994	V116I	possibly damaging	Het
Plod2	G	A	9: 92,584,604		probably null	Het
Ppfibp2	T	C	7: 107,740,589	Y730H	probably damaging	Het
Ptprh	T	C	7: 4,601,913	E44G	probably benign	Het
Rab11fip1	T	C	8: 27,152,410	E787G	probably damaging	Het
Rabep2	T	A	7: 126,444,272	L448Q	probably damaging	Het
Rbfox3	A	G	11: 118,496,936		probably null	Het
Rgma	T	C	7: 73,409,412	V88A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf125	A	G	18: 20,977,816	T44A	probably benign	Het
Rusc2	G	T	4: 43,426,046	A1384S	probably benign	Het
Selp	T	A	1: 164,141,440	C536*	probably null	Het
Serpinb3c	G	A	1: 107,271,774	T339I	probably damaging	Het
Slc4a5	C	T	6: 83,296,635	R986C	probably damaging	Het
Slc8b1	T	C	5: 120,521,115	I208T	probably benign	Het
Sp3	G	A	2: 72,946,655	H533Y	probably damaging	Het
Tiam2	A	G	17: 3,518,423	R1615G	probably damaging	Het
Tie1	T	C	4: 118,476,263	E802G	probably damaging	Het
Tinagl1	A	G	4: 130,168,049	V164A	probably benign	Het
Vmn1r68	A	G	7: 10,527,875	Y99H	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r56	T	C	7: 12,733,045	T21A	probably benign	Het
Zfp108	C	A	7: 24,258,539	H34Q	possibly damaging	Het
Zfp456	C	T	13: 67,366,555	S344N	probably benign	Het
Zscan22	T	C	7: 12,906,980	C384R	probably damaging	Het

Other mutations in Fuk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Fuk	APN	8	110890476	missense	possibly damaging	0.75
IGL01963:Fuk	APN	8	110893402	missense	probably damaging	1.00
IGL01986:Fuk	APN	8	110883257	missense	probably benign
PIT4283001:Fuk	UTSW	8	110887432	missense	probably benign	0.05
R0008:Fuk	UTSW	8	110884233	splice site	probably benign
R0032:Fuk	UTSW	8	110892103	missense	possibly damaging	0.55
R0032:Fuk	UTSW	8	110892103	missense	possibly damaging	0.55
R0057:Fuk	UTSW	8	110893768	splice site	probably benign
R0057:Fuk	UTSW	8	110893768	splice site	probably benign
R0280:Fuk	UTSW	8	110894748	missense	probably damaging	1.00
R0285:Fuk	UTSW	8	110893717	missense	probably benign	0.08
R0359:Fuk	UTSW	8	110893259	splice site	probably null
R0587:Fuk	UTSW	8	110883325	missense	probably damaging	0.98
R1528:Fuk	UTSW	8	110883241	missense	probably damaging	1.00
R1907:Fuk	UTSW	8	110893378	nonsense	probably null
R2152:Fuk	UTSW	8	110889072	missense	probably benign	0.03
R2154:Fuk	UTSW	8	110889072	missense	probably benign	0.03
R2392:Fuk	UTSW	8	110889724	missense	probably benign
R3037:Fuk	UTSW	8	110894718	splice site	probably null
R3714:Fuk	UTSW	8	110887259	missense	probably damaging	1.00
R3765:Fuk	UTSW	8	110887104	missense	probably benign	0.00
R4307:Fuk	UTSW	8	110892080	nonsense	probably null
R4404:Fuk	UTSW	8	110890301	missense	probably benign	0.03
R4768:Fuk	UTSW	8	110892134	missense	probably benign	0.00
R4998:Fuk	UTSW	8	110887803	missense	probably damaging	0.96
R5009:Fuk	UTSW	8	110887830	missense	probably damaging	0.99
R5253:Fuk	UTSW	8	110883867	missense	possibly damaging	0.90
R6257:Fuk	UTSW	8	110890545	missense	probably benign	0.00
R6430:Fuk	UTSW	8	110884116	missense	probably benign	0.16
R6536:Fuk	UTSW	8	110883879	missense	possibly damaging	0.47
R6599:Fuk	UTSW	8	110893283	splice site	probably null
R6799:Fuk	UTSW	8	110893418	missense	probably benign
R7051:Fuk	UTSW	8	110890339	missense	probably damaging	0.97
R7184:Fuk	UTSW	8	110887156	missense	probably damaging	1.00
R7241:Fuk	UTSW	8	110895897	missense	probably benign
R7448:Fuk	UTSW	8	110890331	missense	possibly damaging	0.93
R8081:Fuk	UTSW	8	110889151	missense	probably benign
R8094:Fuk	UTSW	8	110895972	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCAAGAACCGCAGGTCCCAGAG -3'
(R):5'- CCATTGGTCTGTTGAGCCTCAGTC -3'

Sequencing Primer
(F):5'- AGGTCCCAGAGCACAGG -3'
(R):5'- gggagggcaagcagcag -3'

Posted On

2014-05-23