Incidental Mutation 'R1731:Cep131'
ID199336
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Namecentrosomal protein 131
SynonymsAzi1, AZ1
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120064430-120086827 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 120076916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
Predicted Effect probably null
Transcript: ENSMUST00000106227
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106229
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144128
Predicted Effect probably null
Transcript: ENSMUST00000180242
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 120077009 missense possibly damaging 0.55
IGL01522:Cep131 APN 11 120067163 missense probably benign 0.09
IGL01524:Cep131 APN 11 120065960 missense probably damaging 1.00
IGL02477:Cep131 APN 11 120070580 missense probably damaging 1.00
R0565:Cep131 UTSW 11 120073762 missense probably damaging 0.97
R1739:Cep131 UTSW 11 120083906 missense probably benign 0.01
R1797:Cep131 UTSW 11 120073736 splice site probably null
R2444:Cep131 UTSW 11 120070495 missense probably damaging 1.00
R2899:Cep131 UTSW 11 120072028 missense probably benign 0.01
R3854:Cep131 UTSW 11 120067185 nonsense probably null
R3856:Cep131 UTSW 11 120067185 nonsense probably null
R4446:Cep131 UTSW 11 120064819 missense probably damaging 1.00
R4624:Cep131 UTSW 11 120070832 missense probably damaging 1.00
R4838:Cep131 UTSW 11 120076156 missense probably damaging 1.00
R4892:Cep131 UTSW 11 120068057 missense probably damaging 0.99
R5170:Cep131 UTSW 11 120070609 missense probably damaging 0.99
R6128:Cep131 UTSW 11 120065975 missense probably damaging 1.00
R6179:Cep131 UTSW 11 120066011 missense probably benign 0.13
R6362:Cep131 UTSW 11 120064690 missense probably damaging 0.99
R6630:Cep131 UTSW 11 120073815 missense probably damaging 1.00
R6786:Cep131 UTSW 11 120065392 missense probably damaging 1.00
R6846:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R6847:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R7210:Cep131 UTSW 11 120064789 missense probably damaging 0.96
R7569:Cep131 UTSW 11 120066713 missense probably damaging 1.00
RF015:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
RF054:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTGTTGAGCTGACCACTGATAC -3'
(R):5'- AGCATCTGCTGCCTCATGACAC -3'

Sequencing Primer
(F):5'- CACTGATACTGTCTAAACAGTGGC -3'
(R):5'- ACACATAAGGGCCTGCTGTTG -3'
Posted On2014-05-23