Incidental Mutation 'R1731:Adam7'
ID199343
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68525356 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 140 (Y140F)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably damaging
Transcript: ENSMUST00000022640
AA Change: Y140F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: Y140F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 splice site probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R8135:Adam7 UTSW 14 68516573 missense probably damaging 1.00
R8281:Adam7 UTSW 14 68507885 missense possibly damaging 0.65
R8507:Adam7 UTSW 14 68526324 missense probably damaging 1.00
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CGGGACTGCTGGAACACCATAAAAG -3'
(R):5'- ATTGCTGACTCACTGAGAGGCCAC -3'

Sequencing Primer
(F):5'- AAGGGGGATTAAAGTACTCACTTCTG -3'
(R):5'- ACTGAGAGGCCACAGTGC -3'
Posted On2014-05-23