Incidental Mutation 'R1731:Mta2'
ID199353
Institutional Source Beutler Lab
Gene Symbol Mta2
Ensembl Gene ENSMUSG00000071646
Gene Namemetastasis-associated gene family, member 2
SynonymsMta1l1, mmta2
MMRRC Submission 039763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8941875-8952303 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 8947724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096240]
Predicted Effect probably null
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169535
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic and perinatal lethality, reduced weight, shortened lifespan, and increased susceptibility to systemic lupus erythematosus with increased T cell proliferation under Th2 conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Slc8b1 T C 5: 120,521,115 I208T probably benign Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Mta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Mta2 APN 19 8947101 missense probably benign 0.23
IGL01098:Mta2 APN 19 8946717 missense probably damaging 0.98
IGL01148:Mta2 APN 19 8948304 missense probably damaging 0.98
IGL01897:Mta2 APN 19 8947766 nonsense probably null
IGL02054:Mta2 APN 19 8950912 missense probably benign
IGL02157:Mta2 APN 19 8947249 splice site probably benign
IGL02452:Mta2 APN 19 8950306 missense probably benign 0.00
IGL02563:Mta2 APN 19 8948051 missense probably benign
IGL02626:Mta2 APN 19 8949168 missense probably damaging 1.00
IGL02695:Mta2 APN 19 8948364 missense probably benign 0.01
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1301:Mta2 UTSW 19 8949186 splice site probably benign
R1990:Mta2 UTSW 19 8942332 unclassified probably benign
R2116:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R2117:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R4614:Mta2 UTSW 19 8948128 splice site probably null
R4710:Mta2 UTSW 19 8949153 missense probably damaging 1.00
R4801:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4802:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4947:Mta2 UTSW 19 8946291 missense possibly damaging 0.68
R4999:Mta2 UTSW 19 8950383 missense probably benign
R5340:Mta2 UTSW 19 8942356 start codon destroyed probably null 0.89
R5518:Mta2 UTSW 19 8948092 missense probably benign 0.01
R6044:Mta2 UTSW 19 8948331 missense probably damaging 0.99
R7096:Mta2 UTSW 19 8947775 missense probably damaging 1.00
R7604:Mta2 UTSW 19 8945836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGATGGAGCTAGGATCACATGCC -3'
(R):5'- GCCAGGTTTTGAACCCACAGAAATG -3'

Sequencing Primer
(F):5'- AGCTACCCTGGAAGTCACTTG -3'
(R):5'- ggggattaagcctacagcc -3'
Posted On2014-05-23