Incidental Mutation 'R1732:Hdac4'
ID199359
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 039764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1732 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91947535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 905 (T905S)
Ref Sequence ENSEMBL: ENSMUSP00000095249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644]
Predicted Effect probably benign
Transcript: ENSMUST00000008995
AA Change: T905S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313
AA Change: T905S

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097644
AA Change: T905S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Meta Mutation Damage Score 0.0787 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,219,221 Q1445K probably benign Het
Acacb A T 5: 114,190,087 M303L possibly damaging Het
Actl9 T C 17: 33,433,122 V52A probably damaging Het
Adam7 T C 14: 68,498,450 T781A probably benign Het
Agpat4 T C 17: 12,216,728 V293A probably benign Het
Ank1 T A 8: 23,111,463 probably benign Het
Atp1a1 C A 3: 101,584,799 G587V probably damaging Het
Avpr1b T C 1: 131,600,254 F172L probably damaging Het
Bmp1 A T 14: 70,486,265 D710E possibly damaging Het
Cep126 A T 9: 8,099,761 I924N probably benign Het
Chek2 G T 5: 110,872,102 A517S probably benign Het
Cmbl A T 15: 31,588,232 E165D probably damaging Het
Cntnap3 A T 13: 64,740,812 probably null Het
Col1a1 A T 11: 94,944,415 probably benign Het
Ctbp2 T C 7: 132,998,924 M624V possibly damaging Het
Cwc15 A G 9: 14,510,247 D203G probably benign Het
Cyld C T 8: 88,731,667 probably benign Het
Cyp3a57 A T 5: 145,365,645 I84F probably damaging Het
Dennd3 T A 15: 73,537,418 probably benign Het
Desi2 A C 1: 178,256,651 probably benign Het
Dmxl1 T A 18: 49,893,444 L1873* probably null Het
Dmxl1 T A 18: 49,902,988 H2359Q probably benign Het
Ephb4 A G 5: 137,372,178 N880S possibly damaging Het
F10 T C 8: 13,050,764 L214P probably damaging Het
F5 G A 1: 164,174,150 V141M probably damaging Het
Fam135a A T 1: 24,026,653 S1022T possibly damaging Het
Fam13b A T 18: 34,487,134 N232K probably benign Het
Fyco1 T C 9: 123,819,092 E1259G probably benign Het
Gak A T 5: 108,576,582 D1087E probably benign Het
Gm7138 A T 10: 77,776,848 probably benign Het
Gm8674 T A 13: 49,901,926 noncoding transcript Het
Gpr25 A G 1: 136,260,128 V249A probably benign Het
Hcn3 T C 3: 89,148,119 H607R probably damaging Het
Itgad T C 7: 128,205,107 S86P probably benign Het
Itgb4 G T 11: 115,988,918 R632L probably damaging Het
Kcnb2 A T 1: 15,709,755 T284S probably benign Het
Klhl22 T A 16: 17,777,024 M339K probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mybpc2 C A 7: 44,513,675 V484L probably benign Het
Noa1 A T 5: 77,306,374 V473E probably benign Het
Nwd1 C G 8: 72,666,835 S242C possibly damaging Het
Olfr545 C A 7: 102,494,040 C245F probably damaging Het
Olfr868 A G 9: 20,101,500 H247R probably damaging Het
Otof A T 5: 30,386,471 W535R probably damaging Het
Peg3 T C 7: 6,709,085 E1046G possibly damaging Het
Phldb2 T C 16: 45,757,166 E1132G probably damaging Het
Phtf2 A T 5: 20,789,627 probably null Het
Plce1 G T 19: 38,716,838 A896S possibly damaging Het
Prim1 T C 10: 128,015,324 Y26H probably damaging Het
Prr12 T A 7: 45,048,356 T712S unknown Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Ptpdc1 T C 13: 48,586,545 E409G probably benign Het
Rabep1 A G 11: 70,904,641 N274S probably damaging Het
Rbm14 A G 19: 4,803,467 S296P probably benign Het
Rec114 A G 9: 58,653,106 S206P probably damaging Het
Rps6ka1 A T 4: 133,860,070 Y531N probably damaging Het
Slc28a2 T C 2: 122,449,758 probably benign Het
Slc34a1 A G 13: 55,413,420 H566R probably benign Het
Slc9c1 A G 16: 45,552,928 T290A probably benign Het
Smarcc1 T A 9: 110,185,820 probably benign Het
Srp54b T A 12: 55,252,759 probably null Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Synj1 T C 16: 90,964,230 K710E probably damaging Het
Tenm3 T A 8: 48,310,634 D795V probably damaging Het
Tgm2 T C 2: 158,134,357 Y149C probably damaging Het
Tmem151a C A 19: 5,082,867 A104S probably damaging Het
Top1mt A G 15: 75,666,251 probably null Het
Tpgs1 T A 10: 79,675,594 L190Q possibly damaging Het
Triobp T A 15: 78,967,228 H527Q possibly damaging Het
Tspan2 A G 3: 102,768,877 I197V probably damaging Het
Ube3b A G 5: 114,387,445 I76V probably benign Het
Vmn1r32 A T 6: 66,553,301 S164T probably benign Het
Zfp607a G T 7: 27,878,459 C318F probably damaging Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0288:Hdac4 UTSW 1 91971006 missense probably damaging 1.00
R0334:Hdac4 UTSW 1 91956038 splice site probably benign
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R2384:Hdac4 UTSW 1 91984485 missense probably benign 0.02
R3705:Hdac4 UTSW 1 91934694 splice site probably benign
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R4440:Hdac4 UTSW 1 91945995 missense probably damaging 1.00
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 splice site probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
R7002:Hdac4 UTSW 1 91968361 missense possibly damaging 0.85
R7781:Hdac4 UTSW 1 91975665 missense probably benign 0.41
R7966:Hdac4 UTSW 1 91933680 missense possibly damaging 0.71
R8156:Hdac4 UTSW 1 91958416 missense probably damaging 0.99
R8732:Hdac4 UTSW 1 91947517 missense probably damaging 1.00
R8957:Hdac4 UTSW 1 91946035 critical splice acceptor site probably null
Z1177:Hdac4 UTSW 1 91956047 missense probably damaging 1.00
Z1177:Hdac4 UTSW 1 91987611 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGTCAGCTAGGTGGTACTGGG -3'
(R):5'- AAGGGAGAGGCGTTTGCATTGC -3'

Sequencing Primer
(F):5'- AGGTGAGAGCCCTCCATTG -3'
(R):5'- GCTTTCTTTCCAATTCCACTGAAG -3'
Posted On2014-05-23