Incidental Mutation 'R1732:Atp1a1'
ID199367
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene NameATPase, Na+/K+ transporting, alpha 1 polypeptide
SynonymsAtpa-1
MMRRC Submission 039764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1732 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101576219-101604684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101584799 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 587 (G587V)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
Predicted Effect probably damaging
Transcript: ENSMUST00000036493
AA Change: G587V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: G587V

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197360
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,219,221 Q1445K probably benign Het
Acacb A T 5: 114,190,087 M303L possibly damaging Het
Actl9 T C 17: 33,433,122 V52A probably damaging Het
Adam7 T C 14: 68,498,450 T781A probably benign Het
Agpat4 T C 17: 12,216,728 V293A probably benign Het
Ank1 T A 8: 23,111,463 probably benign Het
Avpr1b T C 1: 131,600,254 F172L probably damaging Het
Bmp1 A T 14: 70,486,265 D710E possibly damaging Het
Cep126 A T 9: 8,099,761 I924N probably benign Het
Chek2 G T 5: 110,872,102 A517S probably benign Het
Cmbl A T 15: 31,588,232 E165D probably damaging Het
Cntnap3 A T 13: 64,740,812 probably null Het
Col1a1 A T 11: 94,944,415 probably benign Het
Ctbp2 T C 7: 132,998,924 M624V possibly damaging Het
Cwc15 A G 9: 14,510,247 D203G probably benign Het
Cyld C T 8: 88,731,667 probably benign Het
Cyp3a57 A T 5: 145,365,645 I84F probably damaging Het
Dennd3 T A 15: 73,537,418 probably benign Het
Desi2 A C 1: 178,256,651 probably benign Het
Dmxl1 T A 18: 49,893,444 L1873* probably null Het
Dmxl1 T A 18: 49,902,988 H2359Q probably benign Het
Ephb4 A G 5: 137,372,178 N880S possibly damaging Het
F10 T C 8: 13,050,764 L214P probably damaging Het
F5 G A 1: 164,174,150 V141M probably damaging Het
Fam135a A T 1: 24,026,653 S1022T possibly damaging Het
Fam13b A T 18: 34,487,134 N232K probably benign Het
Fyco1 T C 9: 123,819,092 E1259G probably benign Het
Gak A T 5: 108,576,582 D1087E probably benign Het
Gm7138 A T 10: 77,776,848 probably benign Het
Gm8674 T A 13: 49,901,926 noncoding transcript Het
Gpr25 A G 1: 136,260,128 V249A probably benign Het
Hcn3 T C 3: 89,148,119 H607R probably damaging Het
Hdac4 T A 1: 91,947,535 T905S probably benign Het
Itgad T C 7: 128,205,107 S86P probably benign Het
Itgb4 G T 11: 115,988,918 R632L probably damaging Het
Kcnb2 A T 1: 15,709,755 T284S probably benign Het
Klhl22 T A 16: 17,777,024 M339K probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mybpc2 C A 7: 44,513,675 V484L probably benign Het
Noa1 A T 5: 77,306,374 V473E probably benign Het
Nwd1 C G 8: 72,666,835 S242C possibly damaging Het
Olfr545 C A 7: 102,494,040 C245F probably damaging Het
Olfr868 A G 9: 20,101,500 H247R probably damaging Het
Otof A T 5: 30,386,471 W535R probably damaging Het
Peg3 T C 7: 6,709,085 E1046G possibly damaging Het
Phldb2 T C 16: 45,757,166 E1132G probably damaging Het
Phtf2 A T 5: 20,789,627 probably null Het
Plce1 G T 19: 38,716,838 A896S possibly damaging Het
Prim1 T C 10: 128,015,324 Y26H probably damaging Het
Prr12 T A 7: 45,048,356 T712S unknown Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Ptpdc1 T C 13: 48,586,545 E409G probably benign Het
Rabep1 A G 11: 70,904,641 N274S probably damaging Het
Rbm14 A G 19: 4,803,467 S296P probably benign Het
Rec114 A G 9: 58,653,106 S206P probably damaging Het
Rps6ka1 A T 4: 133,860,070 Y531N probably damaging Het
Slc28a2 T C 2: 122,449,758 probably benign Het
Slc34a1 A G 13: 55,413,420 H566R probably benign Het
Slc9c1 A G 16: 45,552,928 T290A probably benign Het
Smarcc1 T A 9: 110,185,820 probably benign Het
Srp54b T A 12: 55,252,759 probably null Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Synj1 T C 16: 90,964,230 K710E probably damaging Het
Tenm3 T A 8: 48,310,634 D795V probably damaging Het
Tgm2 T C 2: 158,134,357 Y149C probably damaging Het
Tmem151a C A 19: 5,082,867 A104S probably damaging Het
Top1mt A G 15: 75,666,251 probably null Het
Tpgs1 T A 10: 79,675,594 L190Q possibly damaging Het
Triobp T A 15: 78,967,228 H527Q possibly damaging Het
Tspan2 A G 3: 102,768,877 I197V probably damaging Het
Ube3b A G 5: 114,387,445 I76V probably benign Het
Vmn1r32 A T 6: 66,553,301 S164T probably benign Het
Zfp607a G T 7: 27,878,459 C318F probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGTGCTTCCTTGCCTCCAACTG -3'
(R):5'- GCAACCCAAGATGTTGAAGGGCTG -3'

Sequencing Primer
(F):5'- GCCTCCAACTGCACATCTG -3'
(R):5'- GCAGTGACCCCCACTGTC -3'
Posted On2014-05-23