Mutagenetix > Incidental Mutation

Incidental Mutation 'R1732:Acacb'

199376

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039764-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114190087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 303 (M303L)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582] [ENSMUST00000146841]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: M303L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: M303L

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: M303L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: M303L

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146841
AA Change: M111L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000115432
Gene: ENSMUSG00000042010
AA Change: M111L

Domain	Start	End	E-Value	Type
Pfam:CPSase_L_chain	57	146	6.4e-19	PFAM

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	A	12: 71,219,221	Q1445K	probably benign	Het
Actl9	T	C	17: 33,433,122	V52A	probably damaging	Het
Adam7	T	C	14: 68,498,450	T781A	probably benign	Het
Agpat4	T	C	17: 12,216,728	V293A	probably benign	Het
Ank1	T	A	8: 23,111,463		probably benign	Het
Atp1a1	C	A	3: 101,584,799	G587V	probably damaging	Het
Avpr1b	T	C	1: 131,600,254	F172L	probably damaging	Het
Bmp1	A	T	14: 70,486,265	D710E	possibly damaging	Het
Cep126	A	T	9: 8,099,761	I924N	probably benign	Het
Chek2	G	T	5: 110,872,102	A517S	probably benign	Het
Cmbl	A	T	15: 31,588,232	E165D	probably damaging	Het
Cntnap3	A	T	13: 64,740,812		probably null	Het
Col1a1	A	T	11: 94,944,415		probably benign	Het
Ctbp2	T	C	7: 132,998,924	M624V	possibly damaging	Het
Cwc15	A	G	9: 14,510,247	D203G	probably benign	Het
Cyld	C	T	8: 88,731,667		probably benign	Het
Cyp3a57	A	T	5: 145,365,645	I84F	probably damaging	Het
Dennd3	T	A	15: 73,537,418		probably benign	Het
Desi2	A	C	1: 178,256,651		probably benign	Het
Dmxl1	T	A	18: 49,893,444	L1873*	probably null	Het
Dmxl1	T	A	18: 49,902,988	H2359Q	probably benign	Het
Ephb4	A	G	5: 137,372,178	N880S	possibly damaging	Het
F10	T	C	8: 13,050,764	L214P	probably damaging	Het
F5	G	A	1: 164,174,150	V141M	probably damaging	Het
Fam135a	A	T	1: 24,026,653	S1022T	possibly damaging	Het
Fam13b	A	T	18: 34,487,134	N232K	probably benign	Het
Fyco1	T	C	9: 123,819,092	E1259G	probably benign	Het
Gak	A	T	5: 108,576,582	D1087E	probably benign	Het
Gm7138	A	T	10: 77,776,848		probably benign	Het
Gm8674	T	A	13: 49,901,926		noncoding transcript	Het
Gpr25	A	G	1: 136,260,128	V249A	probably benign	Het
Hcn3	T	C	3: 89,148,119	H607R	probably damaging	Het
Hdac4	T	A	1: 91,947,535	T905S	probably benign	Het
Itgad	T	C	7: 128,205,107	S86P	probably benign	Het
Itgb4	G	T	11: 115,988,918	R632L	probably damaging	Het
Kcnb2	A	T	1: 15,709,755	T284S	probably benign	Het
Klhl22	T	A	16: 17,777,024	M339K	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mybpc2	C	A	7: 44,513,675	V484L	probably benign	Het
Noa1	A	T	5: 77,306,374	V473E	probably benign	Het
Nwd1	C	G	8: 72,666,835	S242C	possibly damaging	Het
Olfr545	C	A	7: 102,494,040	C245F	probably damaging	Het
Olfr868	A	G	9: 20,101,500	H247R	probably damaging	Het
Otof	A	T	5: 30,386,471	W535R	probably damaging	Het
Peg3	T	C	7: 6,709,085	E1046G	possibly damaging	Het
Phldb2	T	C	16: 45,757,166	E1132G	probably damaging	Het
Phtf2	A	T	5: 20,789,627		probably null	Het
Plce1	G	T	19: 38,716,838	A896S	possibly damaging	Het
Prim1	T	C	10: 128,015,324	Y26H	probably damaging	Het
Prr12	T	A	7: 45,048,356	T712S	unknown	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Ptpdc1	T	C	13: 48,586,545	E409G	probably benign	Het
Rabep1	A	G	11: 70,904,641	N274S	probably damaging	Het
Rbm14	A	G	19: 4,803,467	S296P	probably benign	Het
Rec114	A	G	9: 58,653,106	S206P	probably damaging	Het
Rps6ka1	A	T	4: 133,860,070	Y531N	probably damaging	Het
Slc28a2	T	C	2: 122,449,758		probably benign	Het
Slc34a1	A	G	13: 55,413,420	H566R	probably benign	Het
Slc9c1	A	G	16: 45,552,928	T290A	probably benign	Het
Smarcc1	T	A	9: 110,185,820		probably benign	Het
Srp54b	T	A	12: 55,252,759		probably null	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Synj1	T	C	16: 90,964,230	K710E	probably damaging	Het
Tenm3	T	A	8: 48,310,634	D795V	probably damaging	Het
Tgm2	T	C	2: 158,134,357	Y149C	probably damaging	Het
Tmem151a	C	A	19: 5,082,867	A104S	probably damaging	Het
Top1mt	A	G	15: 75,666,251		probably null	Het
Tpgs1	T	A	10: 79,675,594	L190Q	possibly damaging	Het
Triobp	T	A	15: 78,967,228	H527Q	possibly damaging	Het
Tspan2	A	G	3: 102,768,877	I197V	probably damaging	Het
Ube3b	A	G	5: 114,387,445	I76V	probably benign	Het
Vmn1r32	A	T	6: 66,553,301	S164T	probably benign	Het
Zfp607a	G	T	7: 27,878,459	C318F	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGACTAATAATACCCATCCCCGCCTTT -3'
(R):5'- TGCATTGCACCCAGCACACT -3'

Sequencing Primer
(F):5'- TTATCCTAAAGCATAGCCATTGCC -3'
(R):5'- ACTGCTGTGTCCCATCAGG -3'

Posted On

2014-05-23