Mutagenetix > Incidental Mutations

Incidental Mutation 'R1732:Ube3b'

199377

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

039764-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114387445 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 76 (I76V)

Ref Sequence

ENSEMBL: ENSMUSP00000138723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]

Predicted Effect

probably benign
Transcript: ENSMUST00000074002
AA Change: I76V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I76V

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169
AA Change: I76V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: I76V

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151809

SMART Domains

Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	5.6e-5	SMART

Meta Mutation Damage Score

0.054

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	A	12: 71,219,221	Q1445K	probably benign	Het
Acacb	A	T	5: 114,190,087	M303L	possibly damaging	Het
Actl9	T	C	17: 33,433,122	V52A	probably damaging	Het
Adam7	T	C	14: 68,498,450	T781A	probably benign	Het
Agpat4	T	C	17: 12,216,728	V293A	probably benign	Het
Ank1	T	A	8: 23,111,463		probably benign	Het
Atp1a1	C	A	3: 101,584,799	G587V	probably damaging	Het
Avpr1b	T	C	1: 131,600,254	F172L	probably damaging	Het
Bmp1	A	T	14: 70,486,265	D710E	possibly damaging	Het
Cep126	A	T	9: 8,099,761	I924N	probably benign	Het
Chek2	G	T	5: 110,872,102	A517S	probably benign	Het
Cmbl	A	T	15: 31,588,232	E165D	probably damaging	Het
Cntnap3	A	T	13: 64,740,812		probably null	Het
Col1a1	A	T	11: 94,944,415		probably benign	Het
Ctbp2	T	C	7: 132,998,924	M624V	possibly damaging	Het
Cwc15	A	G	9: 14,510,247	D203G	probably benign	Het
Cyld	C	T	8: 88,731,667		probably benign	Het
Cyp3a57	A	T	5: 145,365,645	I84F	probably damaging	Het
Dennd3	T	A	15: 73,537,418		probably benign	Het
Desi2	A	C	1: 178,256,651		probably benign	Het
Dmxl1	T	A	18: 49,893,444	L1873*	probably null	Het
Dmxl1	T	A	18: 49,902,988	H2359Q	probably benign	Het
Ephb4	A	G	5: 137,372,178	N880S	possibly damaging	Het
F10	T	C	8: 13,050,764	L214P	probably damaging	Het
F5	G	A	1: 164,174,150	V141M	probably damaging	Het
Fam135a	A	T	1: 24,026,653	S1022T	possibly damaging	Het
Fam13b	A	T	18: 34,487,134	N232K	probably benign	Het
Fyco1	T	C	9: 123,819,092	E1259G	probably benign	Het
Gak	A	T	5: 108,576,582	D1087E	probably benign	Het
Gm7138	A	T	10: 77,776,848		probably benign	Het
Gm8674	T	A	13: 49,901,926		noncoding transcript	Het
Gpr25	A	G	1: 136,260,128	V249A	probably benign	Het
Hcn3	T	C	3: 89,148,119	H607R	probably damaging	Het
Hdac4	T	A	1: 91,947,535	T905S	probably benign	Het
Itgad	T	C	7: 128,205,107	S86P	probably benign	Het
Itgb4	G	T	11: 115,988,918	R632L	probably damaging	Het
Kcnb2	A	T	1: 15,709,755	T284S	probably benign	Het
Klhl22	T	A	16: 17,777,024	M339K	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mybpc2	C	A	7: 44,513,675	V484L	probably benign	Het
Noa1	A	T	5: 77,306,374	V473E	probably benign	Het
Nwd1	C	G	8: 72,666,835	S242C	possibly damaging	Het
Olfr545	C	A	7: 102,494,040	C245F	probably damaging	Het
Olfr868	A	G	9: 20,101,500	H247R	probably damaging	Het
Otof	A	T	5: 30,386,471	W535R	probably damaging	Het
Peg3	T	C	7: 6,709,085	E1046G	possibly damaging	Het
Phldb2	T	C	16: 45,757,166	E1132G	probably damaging	Het
Phtf2	A	T	5: 20,789,627		probably null	Het
Plce1	G	T	19: 38,716,838	A896S	possibly damaging	Het
Prim1	T	C	10: 128,015,324	Y26H	probably damaging	Het
Prr12	T	A	7: 45,048,356	T712S	unknown	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Ptpdc1	T	C	13: 48,586,545	E409G	probably benign	Het
Rabep1	A	G	11: 70,904,641	N274S	probably damaging	Het
Rbm14	A	G	19: 4,803,467	S296P	probably benign	Het
Rec114	A	G	9: 58,653,106	S206P	probably damaging	Het
Rps6ka1	A	T	4: 133,860,070	Y531N	probably damaging	Het
Slc28a2	T	C	2: 122,449,758		probably benign	Het
Slc34a1	A	G	13: 55,413,420	H566R	probably benign	Het
Slc9c1	A	G	16: 45,552,928	T290A	probably benign	Het
Smarcc1	T	A	9: 110,185,820		probably benign	Het
Srp54b	T	A	12: 55,252,759		probably null	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Synj1	T	C	16: 90,964,230	K710E	probably damaging	Het
Tenm3	T	A	8: 48,310,634	D795V	probably damaging	Het
Tgm2	T	C	2: 158,134,357	Y149C	probably damaging	Het
Tmem151a	C	A	19: 5,082,867	A104S	probably damaging	Het
Top1mt	A	G	15: 75,666,251		probably null	Het
Tpgs1	T	A	10: 79,675,594	L190Q	possibly damaging	Het
Triobp	T	A	15: 78,967,228	H527Q	possibly damaging	Het
Tspan2	A	G	3: 102,768,877	I197V	probably damaging	Het
Vmn1r32	A	T	6: 66,553,301	S164T	probably benign	Het
Zfp607a	G	T	7: 27,878,459	C318F	probably damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	intron	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	intron	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTCCAGAGCATGGTTCATCGACAG -3'
(R):5'- CAGTTAACGTGCAGAGACCTCCAG -3'

Sequencing Primer
(F):5'- ATGGTTCATCGACAGAGCCC -3'
(R):5'- GGGGATGGTGTGCCTTAAACTA -3'

Posted On

2014-05-23