Incidental Mutation 'R1732:Tenm3'
ID 199393
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission 039764-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R1732 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48763669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 795 (D795V)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: D795V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: D795V

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: D786V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: D786V

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.5681 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,265,995 (GRCm39) Q1445K probably benign Het
Acacb A T 5: 114,328,148 (GRCm39) M303L possibly damaging Het
Actl9 T C 17: 33,652,096 (GRCm39) V52A probably damaging Het
Adam7 T C 14: 68,735,899 (GRCm39) T781A probably benign Het
Agpat4 T C 17: 12,435,615 (GRCm39) V293A probably benign Het
Ank1 T A 8: 23,601,479 (GRCm39) probably benign Het
Atp1a1 C A 3: 101,492,115 (GRCm39) G587V probably damaging Het
Avpr1b T C 1: 131,527,992 (GRCm39) F172L probably damaging Het
Bmp1 A T 14: 70,723,705 (GRCm39) D710E possibly damaging Het
Cep126 A T 9: 8,099,762 (GRCm39) I924N probably benign Het
Chek2 G T 5: 111,019,968 (GRCm39) A517S probably benign Het
Cmbl A T 15: 31,588,378 (GRCm39) E165D probably damaging Het
Cntnap3 A T 13: 64,888,626 (GRCm39) probably null Het
Col1a1 A T 11: 94,835,241 (GRCm39) probably benign Het
Ctbp2 T C 7: 132,600,653 (GRCm39) M624V possibly damaging Het
Cwc15 A G 9: 14,421,543 (GRCm39) D203G probably benign Het
Cyld C T 8: 89,458,295 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,302,455 (GRCm39) I84F probably damaging Het
Dennd3 T A 15: 73,409,267 (GRCm39) probably benign Het
Desi2 A C 1: 178,084,217 (GRCm39) probably benign Het
Dmxl1 T A 18: 50,026,511 (GRCm39) L1873* probably null Het
Dmxl1 T A 18: 50,036,055 (GRCm39) H2359Q probably benign Het
Ephb4 A G 5: 137,370,440 (GRCm39) N880S possibly damaging Het
F10 T C 8: 13,100,764 (GRCm39) L214P probably damaging Het
F5 G A 1: 164,001,719 (GRCm39) V141M probably damaging Het
Fam135a A T 1: 24,065,734 (GRCm39) S1022T possibly damaging Het
Fam13b A T 18: 34,620,187 (GRCm39) N232K probably benign Het
Fyco1 T C 9: 123,648,157 (GRCm39) E1259G probably benign Het
Gak A T 5: 108,724,448 (GRCm39) D1087E probably benign Het
Gm7138 A T 10: 77,612,682 (GRCm39) probably benign Het
Gm8674 T A 13: 50,055,962 (GRCm39) noncoding transcript Het
Gpr25 A G 1: 136,187,866 (GRCm39) V249A probably benign Het
Hcn3 T C 3: 89,055,426 (GRCm39) H607R probably damaging Het
Hdac4 T A 1: 91,875,257 (GRCm39) T905S probably benign Het
Itgad T C 7: 127,804,279 (GRCm39) S86P probably benign Het
Itgb4 G T 11: 115,879,744 (GRCm39) R632L probably damaging Het
Kcnb2 A T 1: 15,779,979 (GRCm39) T284S probably benign Het
Klhl22 T A 16: 17,594,888 (GRCm39) M339K probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mybpc2 C A 7: 44,163,099 (GRCm39) V484L probably benign Het
Noa1 A T 5: 77,454,221 (GRCm39) V473E probably benign Het
Nwd1 C G 8: 73,393,463 (GRCm39) S242C possibly damaging Het
Or55b10 C A 7: 102,143,247 (GRCm39) C245F probably damaging Het
Or7e174 A G 9: 20,012,796 (GRCm39) H247R probably damaging Het
Otof A T 5: 30,543,815 (GRCm39) W535R probably damaging Het
Peg3 T C 7: 6,712,084 (GRCm39) E1046G possibly damaging Het
Phldb2 T C 16: 45,577,529 (GRCm39) E1132G probably damaging Het
Phtf2 A T 5: 20,994,625 (GRCm39) probably null Het
Plce1 G T 19: 38,705,282 (GRCm39) A896S possibly damaging Het
Prim1 T C 10: 127,851,193 (GRCm39) Y26H probably damaging Het
Prr12 T A 7: 44,697,780 (GRCm39) T712S unknown Het
Psme4 G A 11: 30,798,105 (GRCm39) R1366H probably benign Het
Ptpdc1 T C 13: 48,740,021 (GRCm39) E409G probably benign Het
Rabep1 A G 11: 70,795,467 (GRCm39) N274S probably damaging Het
Rbm14 A G 19: 4,853,495 (GRCm39) S296P probably benign Het
Rec114 A G 9: 58,560,389 (GRCm39) S206P probably damaging Het
Rps6ka1 A T 4: 133,587,381 (GRCm39) Y531N probably damaging Het
Slc28a2 T C 2: 122,280,239 (GRCm39) probably benign Het
Slc34a1 A G 13: 55,561,233 (GRCm39) H566R probably benign Het
Slc9c1 A G 16: 45,373,291 (GRCm39) T290A probably benign Het
Smarcc1 T A 9: 110,014,888 (GRCm39) probably benign Het
Srp54b T A 12: 55,299,544 (GRCm39) probably null Het
Stambpl1 C G 19: 34,204,121 (GRCm39) N70K probably damaging Het
Synj1 T C 16: 90,761,118 (GRCm39) K710E probably damaging Het
Tgm2 T C 2: 157,976,277 (GRCm39) Y149C probably damaging Het
Tmem151a C A 19: 5,132,895 (GRCm39) A104S probably damaging Het
Top1mt A G 15: 75,538,100 (GRCm39) probably null Het
Tpgs1 T A 10: 79,511,428 (GRCm39) L190Q possibly damaging Het
Triobp T A 15: 78,851,428 (GRCm39) H527Q possibly damaging Het
Tspan2 A G 3: 102,676,193 (GRCm39) I197V probably damaging Het
Ube3b A G 5: 114,525,506 (GRCm39) I76V probably benign Het
Vmn1r32 A T 6: 66,530,285 (GRCm39) S164T probably benign Het
Zfp607a G T 7: 27,577,884 (GRCm39) C318F probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1768:Tenm3 UTSW 8 48,685,139 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,681,703 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,754,006 (GRCm39) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6062:Tenm3 UTSW 8 48,796,441 (GRCm39) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9336:Tenm3 UTSW 8 48,870,115 (GRCm39) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTGCAATCAAGCCATCAGCAG -3'
(R):5'- GTCTCAAGGGTCAGGCCAATCAAAG -3'

Sequencing Primer
(F):5'- ATCAGCAGCCACACATTTTC -3'
(R):5'- CAATCAAAGATGCCACTTTGGG -3'
Posted On 2014-05-23