Incidental Mutation 'R1732:Srp54b'
ID199411
Institutional Source Beutler Lab
Gene Symbol Srp54b
Ensembl Gene ENSMUSG00000112449
Gene Namesignal recognition particle 54B
Synonyms
MMRRC Submission 039764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1732 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55155104-55189573 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55252759 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164243] [ENSMUST00000164243] [ENSMUST00000218879]
Predicted Effect probably null
Transcript: ENSMUST00000164243
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164243
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218879
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,219,221 Q1445K probably benign Het
Acacb A T 5: 114,190,087 M303L possibly damaging Het
Actl9 T C 17: 33,433,122 V52A probably damaging Het
Adam7 T C 14: 68,498,450 T781A probably benign Het
Agpat4 T C 17: 12,216,728 V293A probably benign Het
Ank1 T A 8: 23,111,463 probably benign Het
Atp1a1 C A 3: 101,584,799 G587V probably damaging Het
Avpr1b T C 1: 131,600,254 F172L probably damaging Het
Bmp1 A T 14: 70,486,265 D710E possibly damaging Het
Cep126 A T 9: 8,099,761 I924N probably benign Het
Chek2 G T 5: 110,872,102 A517S probably benign Het
Cmbl A T 15: 31,588,232 E165D probably damaging Het
Cntnap3 A T 13: 64,740,812 probably null Het
Col1a1 A T 11: 94,944,415 probably benign Het
Ctbp2 T C 7: 132,998,924 M624V possibly damaging Het
Cwc15 A G 9: 14,510,247 D203G probably benign Het
Cyld C T 8: 88,731,667 probably benign Het
Cyp3a57 A T 5: 145,365,645 I84F probably damaging Het
Dennd3 T A 15: 73,537,418 probably benign Het
Desi2 A C 1: 178,256,651 probably benign Het
Dmxl1 T A 18: 49,893,444 L1873* probably null Het
Dmxl1 T A 18: 49,902,988 H2359Q probably benign Het
Ephb4 A G 5: 137,372,178 N880S possibly damaging Het
F10 T C 8: 13,050,764 L214P probably damaging Het
F5 G A 1: 164,174,150 V141M probably damaging Het
Fam135a A T 1: 24,026,653 S1022T possibly damaging Het
Fam13b A T 18: 34,487,134 N232K probably benign Het
Fyco1 T C 9: 123,819,092 E1259G probably benign Het
Gak A T 5: 108,576,582 D1087E probably benign Het
Gm7138 A T 10: 77,776,848 probably benign Het
Gm8674 T A 13: 49,901,926 noncoding transcript Het
Gpr25 A G 1: 136,260,128 V249A probably benign Het
Hcn3 T C 3: 89,148,119 H607R probably damaging Het
Hdac4 T A 1: 91,947,535 T905S probably benign Het
Itgad T C 7: 128,205,107 S86P probably benign Het
Itgb4 G T 11: 115,988,918 R632L probably damaging Het
Kcnb2 A T 1: 15,709,755 T284S probably benign Het
Klhl22 T A 16: 17,777,024 M339K probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mybpc2 C A 7: 44,513,675 V484L probably benign Het
Noa1 A T 5: 77,306,374 V473E probably benign Het
Nwd1 C G 8: 72,666,835 S242C possibly damaging Het
Olfr545 C A 7: 102,494,040 C245F probably damaging Het
Olfr868 A G 9: 20,101,500 H247R probably damaging Het
Otof A T 5: 30,386,471 W535R probably damaging Het
Peg3 T C 7: 6,709,085 E1046G possibly damaging Het
Phldb2 T C 16: 45,757,166 E1132G probably damaging Het
Phtf2 A T 5: 20,789,627 probably null Het
Plce1 G T 19: 38,716,838 A896S possibly damaging Het
Prim1 T C 10: 128,015,324 Y26H probably damaging Het
Prr12 T A 7: 45,048,356 T712S unknown Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Ptpdc1 T C 13: 48,586,545 E409G probably benign Het
Rabep1 A G 11: 70,904,641 N274S probably damaging Het
Rbm14 A G 19: 4,803,467 S296P probably benign Het
Rec114 A G 9: 58,653,106 S206P probably damaging Het
Rps6ka1 A T 4: 133,860,070 Y531N probably damaging Het
Slc28a2 T C 2: 122,449,758 probably benign Het
Slc34a1 A G 13: 55,413,420 H566R probably benign Het
Slc9c1 A G 16: 45,552,928 T290A probably benign Het
Smarcc1 T A 9: 110,185,820 probably benign Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Synj1 T C 16: 90,964,230 K710E probably damaging Het
Tenm3 T A 8: 48,310,634 D795V probably damaging Het
Tgm2 T C 2: 158,134,357 Y149C probably damaging Het
Tmem151a C A 19: 5,082,867 A104S probably damaging Het
Top1mt A G 15: 75,666,251 probably null Het
Tpgs1 T A 10: 79,675,594 L190Q possibly damaging Het
Triobp T A 15: 78,967,228 H527Q possibly damaging Het
Tspan2 A G 3: 102,768,877 I197V probably damaging Het
Ube3b A G 5: 114,387,445 I76V probably benign Het
Vmn1r32 A T 6: 66,553,301 S164T probably benign Het
Zfp607a G T 7: 27,878,459 C318F probably damaging Het
Other mutations in Srp54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Srp54b APN 12 55252775 missense probably benign 0.39
R0101:Srp54b UTSW 12 55255620 splice site probably benign
R0395:Srp54b UTSW 12 55250099 missense probably damaging 1.00
R1076:Srp54b UTSW 12 55255528 splice site probably benign
R1186:Srp54b UTSW 12 55255528 splice site probably benign
R1520:Srp54b UTSW 12 55257569 missense possibly damaging 0.68
R1541:Srp54b UTSW 12 55256059 missense probably benign 0.27
R1836:Srp54b UTSW 12 55250160 splice site probably null
R5344:Srp54b UTSW 12 55255581 missense probably damaging 1.00
R5841:Srp54b UTSW 12 55252829 missense probably benign 0.01
R6269:Srp54b UTSW 12 55255972 missense possibly damaging 0.94
R6417:Srp54b UTSW 12 55250070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAATTAGGAGGTCAGCTTTGGG -3'
(R):5'- GCTGCTGGAGGATTTTAGATCAATGGAC -3'

Sequencing Primer
(F):5'- AGCTTTGGGCTGTCTTCC -3'
(R):5'- CGTGCTTCCACTTCTCTATAAGT -3'
Posted On2014-05-23