Incidental Mutation 'R0087:Steap1'
ID19942
Institutional Source Beutler Lab
Gene Symbol Steap1
Ensembl Gene ENSMUSG00000015652
Gene Namesix transmembrane epithelial antigen of the prostate 1
Synonyms2410007B19Rik, Prss24
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R0087 (G1)
Quality Score219
Status Validated (trace)
Chromosome5
Chromosomal Location5736317-5749326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5736664 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 258 (G258R)
Ref Sequence ENSEMBL: ENSMUSP00000015796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015796]
Predicted Effect probably damaging
Transcript: ENSMUST00000015796
AA Change: G258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015796
Gene: ENSMUSG00000015652
AA Change: G258R

DomainStartEndE-ValueType
Pfam:Ferric_reduct 118 264 2e-17 PFAM
transmembrane domain 289 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169542
SMART Domains Protein: ENSMUSP00000126005
Gene: ENSMUSG00000015652

DomainStartEndE-ValueType
Pfam:Ferric_reduct 10 77 2.7e-10 PFAM
Meta Mutation Damage Score 0.7813 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Steap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02492:Steap1 APN 5 5740561 missense possibly damaging 0.87
E0370:Steap1 UTSW 5 5740673 missense probably damaging 1.00
PIT4468001:Steap1 UTSW 5 5736642 missense probably damaging 0.98
R0281:Steap1 UTSW 5 5736431 missense probably benign
R0525:Steap1 UTSW 5 5742903 missense possibly damaging 0.65
R0834:Steap1 UTSW 5 5740357 missense probably damaging 0.98
R1665:Steap1 UTSW 5 5736498 missense probably damaging 1.00
R1941:Steap1 UTSW 5 5740541 missense probably damaging 1.00
R4808:Steap1 UTSW 5 5738829 intron probably benign
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R5004:Steap1 UTSW 5 5742829 nonsense probably null
R5138:Steap1 UTSW 5 5736486 missense probably damaging 0.99
R5330:Steap1 UTSW 5 5740422 missense probably damaging 1.00
R5583:Steap1 UTSW 5 5740579 missense possibly damaging 0.93
R6273:Steap1 UTSW 5 5740827 missense possibly damaging 0.65
R8342:Steap1 UTSW 5 5740816 missense probably benign
R8478:Steap1 UTSW 5 5736432 missense probably benign 0.30
R8850:Steap1 UTSW 5 5740838 missense probably benign 0.01
R8949:Steap1 UTSW 5 5739940 missense probably damaging 0.99
Z1177:Steap1 UTSW 5 5739882 missense probably damaging 0.98
Z1177:Steap1 UTSW 5 5740580 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATCTTCTTCCTCAGACAGGGCAGG -3'
(R):5'- AGCACTGATGGGGCTGAAAATCAC -3'

Sequencing Primer
(F):5'- GGCACAGGGCGATTTTACATATC -3'
(R):5'- TTGCCCAAAGGCAGTGTG -3'
Posted On2013-04-11