Incidental Mutation 'R1732:Triobp'
ID 199422
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 039764-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1732 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78851428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 527 (H527Q)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109689
AA Change: H527Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: H527Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: H527Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: H527Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140228
AA Change: H527Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,265,995 (GRCm39) Q1445K probably benign Het
Acacb A T 5: 114,328,148 (GRCm39) M303L possibly damaging Het
Actl9 T C 17: 33,652,096 (GRCm39) V52A probably damaging Het
Adam7 T C 14: 68,735,899 (GRCm39) T781A probably benign Het
Agpat4 T C 17: 12,435,615 (GRCm39) V293A probably benign Het
Ank1 T A 8: 23,601,479 (GRCm39) probably benign Het
Atp1a1 C A 3: 101,492,115 (GRCm39) G587V probably damaging Het
Avpr1b T C 1: 131,527,992 (GRCm39) F172L probably damaging Het
Bmp1 A T 14: 70,723,705 (GRCm39) D710E possibly damaging Het
Cep126 A T 9: 8,099,762 (GRCm39) I924N probably benign Het
Chek2 G T 5: 111,019,968 (GRCm39) A517S probably benign Het
Cmbl A T 15: 31,588,378 (GRCm39) E165D probably damaging Het
Cntnap3 A T 13: 64,888,626 (GRCm39) probably null Het
Col1a1 A T 11: 94,835,241 (GRCm39) probably benign Het
Ctbp2 T C 7: 132,600,653 (GRCm39) M624V possibly damaging Het
Cwc15 A G 9: 14,421,543 (GRCm39) D203G probably benign Het
Cyld C T 8: 89,458,295 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,302,455 (GRCm39) I84F probably damaging Het
Dennd3 T A 15: 73,409,267 (GRCm39) probably benign Het
Desi2 A C 1: 178,084,217 (GRCm39) probably benign Het
Dmxl1 T A 18: 50,026,511 (GRCm39) L1873* probably null Het
Dmxl1 T A 18: 50,036,055 (GRCm39) H2359Q probably benign Het
Ephb4 A G 5: 137,370,440 (GRCm39) N880S possibly damaging Het
F10 T C 8: 13,100,764 (GRCm39) L214P probably damaging Het
F5 G A 1: 164,001,719 (GRCm39) V141M probably damaging Het
Fam135a A T 1: 24,065,734 (GRCm39) S1022T possibly damaging Het
Fam13b A T 18: 34,620,187 (GRCm39) N232K probably benign Het
Fyco1 T C 9: 123,648,157 (GRCm39) E1259G probably benign Het
Gak A T 5: 108,724,448 (GRCm39) D1087E probably benign Het
Gm7138 A T 10: 77,612,682 (GRCm39) probably benign Het
Gm8674 T A 13: 50,055,962 (GRCm39) noncoding transcript Het
Gpr25 A G 1: 136,187,866 (GRCm39) V249A probably benign Het
Hcn3 T C 3: 89,055,426 (GRCm39) H607R probably damaging Het
Hdac4 T A 1: 91,875,257 (GRCm39) T905S probably benign Het
Itgad T C 7: 127,804,279 (GRCm39) S86P probably benign Het
Itgb4 G T 11: 115,879,744 (GRCm39) R632L probably damaging Het
Kcnb2 A T 1: 15,779,979 (GRCm39) T284S probably benign Het
Klhl22 T A 16: 17,594,888 (GRCm39) M339K probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mybpc2 C A 7: 44,163,099 (GRCm39) V484L probably benign Het
Noa1 A T 5: 77,454,221 (GRCm39) V473E probably benign Het
Nwd1 C G 8: 73,393,463 (GRCm39) S242C possibly damaging Het
Or55b10 C A 7: 102,143,247 (GRCm39) C245F probably damaging Het
Or7e174 A G 9: 20,012,796 (GRCm39) H247R probably damaging Het
Otof A T 5: 30,543,815 (GRCm39) W535R probably damaging Het
Peg3 T C 7: 6,712,084 (GRCm39) E1046G possibly damaging Het
Phldb2 T C 16: 45,577,529 (GRCm39) E1132G probably damaging Het
Phtf2 A T 5: 20,994,625 (GRCm39) probably null Het
Plce1 G T 19: 38,705,282 (GRCm39) A896S possibly damaging Het
Prim1 T C 10: 127,851,193 (GRCm39) Y26H probably damaging Het
Prr12 T A 7: 44,697,780 (GRCm39) T712S unknown Het
Psme4 G A 11: 30,798,105 (GRCm39) R1366H probably benign Het
Ptpdc1 T C 13: 48,740,021 (GRCm39) E409G probably benign Het
Rabep1 A G 11: 70,795,467 (GRCm39) N274S probably damaging Het
Rbm14 A G 19: 4,853,495 (GRCm39) S296P probably benign Het
Rec114 A G 9: 58,560,389 (GRCm39) S206P probably damaging Het
Rps6ka1 A T 4: 133,587,381 (GRCm39) Y531N probably damaging Het
Slc28a2 T C 2: 122,280,239 (GRCm39) probably benign Het
Slc34a1 A G 13: 55,561,233 (GRCm39) H566R probably benign Het
Slc9c1 A G 16: 45,373,291 (GRCm39) T290A probably benign Het
Smarcc1 T A 9: 110,014,888 (GRCm39) probably benign Het
Srp54b T A 12: 55,299,544 (GRCm39) probably null Het
Stambpl1 C G 19: 34,204,121 (GRCm39) N70K probably damaging Het
Synj1 T C 16: 90,761,118 (GRCm39) K710E probably damaging Het
Tenm3 T A 8: 48,763,669 (GRCm39) D795V probably damaging Het
Tgm2 T C 2: 157,976,277 (GRCm39) Y149C probably damaging Het
Tmem151a C A 19: 5,132,895 (GRCm39) A104S probably damaging Het
Top1mt A G 15: 75,538,100 (GRCm39) probably null Het
Tpgs1 T A 10: 79,511,428 (GRCm39) L190Q possibly damaging Het
Tspan2 A G 3: 102,676,193 (GRCm39) I197V probably damaging Het
Ube3b A G 5: 114,525,506 (GRCm39) I76V probably benign Het
Vmn1r32 A T 6: 66,530,285 (GRCm39) S164T probably benign Het
Zfp607a G T 7: 27,577,884 (GRCm39) C318F probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCAACAGAAGTACTCAGCGG -3'
(R):5'- AGAAATGGATGCCCAAGGCACC -3'

Sequencing Primer
(F):5'- AGTACTCAGCGGGACAGC -3'
(R):5'- AGGTTCGGGGACTGTCAC -3'
Posted On 2014-05-23