Incidental Mutation 'R1732:Slc9c1'
ID 199426
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 039764-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R1732 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45373291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 290 (T290A)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: T290A

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: T290A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162151
AA Change: T261A
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.2365 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,265,995 (GRCm39) Q1445K probably benign Het
Acacb A T 5: 114,328,148 (GRCm39) M303L possibly damaging Het
Actl9 T C 17: 33,652,096 (GRCm39) V52A probably damaging Het
Adam7 T C 14: 68,735,899 (GRCm39) T781A probably benign Het
Agpat4 T C 17: 12,435,615 (GRCm39) V293A probably benign Het
Ank1 T A 8: 23,601,479 (GRCm39) probably benign Het
Atp1a1 C A 3: 101,492,115 (GRCm39) G587V probably damaging Het
Avpr1b T C 1: 131,527,992 (GRCm39) F172L probably damaging Het
Bmp1 A T 14: 70,723,705 (GRCm39) D710E possibly damaging Het
Cep126 A T 9: 8,099,762 (GRCm39) I924N probably benign Het
Chek2 G T 5: 111,019,968 (GRCm39) A517S probably benign Het
Cmbl A T 15: 31,588,378 (GRCm39) E165D probably damaging Het
Cntnap3 A T 13: 64,888,626 (GRCm39) probably null Het
Col1a1 A T 11: 94,835,241 (GRCm39) probably benign Het
Ctbp2 T C 7: 132,600,653 (GRCm39) M624V possibly damaging Het
Cwc15 A G 9: 14,421,543 (GRCm39) D203G probably benign Het
Cyld C T 8: 89,458,295 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,302,455 (GRCm39) I84F probably damaging Het
Dennd3 T A 15: 73,409,267 (GRCm39) probably benign Het
Desi2 A C 1: 178,084,217 (GRCm39) probably benign Het
Dmxl1 T A 18: 50,026,511 (GRCm39) L1873* probably null Het
Dmxl1 T A 18: 50,036,055 (GRCm39) H2359Q probably benign Het
Ephb4 A G 5: 137,370,440 (GRCm39) N880S possibly damaging Het
F10 T C 8: 13,100,764 (GRCm39) L214P probably damaging Het
F5 G A 1: 164,001,719 (GRCm39) V141M probably damaging Het
Fam135a A T 1: 24,065,734 (GRCm39) S1022T possibly damaging Het
Fam13b A T 18: 34,620,187 (GRCm39) N232K probably benign Het
Fyco1 T C 9: 123,648,157 (GRCm39) E1259G probably benign Het
Gak A T 5: 108,724,448 (GRCm39) D1087E probably benign Het
Gm7138 A T 10: 77,612,682 (GRCm39) probably benign Het
Gm8674 T A 13: 50,055,962 (GRCm39) noncoding transcript Het
Gpr25 A G 1: 136,187,866 (GRCm39) V249A probably benign Het
Hcn3 T C 3: 89,055,426 (GRCm39) H607R probably damaging Het
Hdac4 T A 1: 91,875,257 (GRCm39) T905S probably benign Het
Itgad T C 7: 127,804,279 (GRCm39) S86P probably benign Het
Itgb4 G T 11: 115,879,744 (GRCm39) R632L probably damaging Het
Kcnb2 A T 1: 15,779,979 (GRCm39) T284S probably benign Het
Klhl22 T A 16: 17,594,888 (GRCm39) M339K probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mybpc2 C A 7: 44,163,099 (GRCm39) V484L probably benign Het
Noa1 A T 5: 77,454,221 (GRCm39) V473E probably benign Het
Nwd1 C G 8: 73,393,463 (GRCm39) S242C possibly damaging Het
Or55b10 C A 7: 102,143,247 (GRCm39) C245F probably damaging Het
Or7e174 A G 9: 20,012,796 (GRCm39) H247R probably damaging Het
Otof A T 5: 30,543,815 (GRCm39) W535R probably damaging Het
Peg3 T C 7: 6,712,084 (GRCm39) E1046G possibly damaging Het
Phldb2 T C 16: 45,577,529 (GRCm39) E1132G probably damaging Het
Phtf2 A T 5: 20,994,625 (GRCm39) probably null Het
Plce1 G T 19: 38,705,282 (GRCm39) A896S possibly damaging Het
Prim1 T C 10: 127,851,193 (GRCm39) Y26H probably damaging Het
Prr12 T A 7: 44,697,780 (GRCm39) T712S unknown Het
Psme4 G A 11: 30,798,105 (GRCm39) R1366H probably benign Het
Ptpdc1 T C 13: 48,740,021 (GRCm39) E409G probably benign Het
Rabep1 A G 11: 70,795,467 (GRCm39) N274S probably damaging Het
Rbm14 A G 19: 4,853,495 (GRCm39) S296P probably benign Het
Rec114 A G 9: 58,560,389 (GRCm39) S206P probably damaging Het
Rps6ka1 A T 4: 133,587,381 (GRCm39) Y531N probably damaging Het
Slc28a2 T C 2: 122,280,239 (GRCm39) probably benign Het
Slc34a1 A G 13: 55,561,233 (GRCm39) H566R probably benign Het
Smarcc1 T A 9: 110,014,888 (GRCm39) probably benign Het
Srp54b T A 12: 55,299,544 (GRCm39) probably null Het
Stambpl1 C G 19: 34,204,121 (GRCm39) N70K probably damaging Het
Synj1 T C 16: 90,761,118 (GRCm39) K710E probably damaging Het
Tenm3 T A 8: 48,763,669 (GRCm39) D795V probably damaging Het
Tgm2 T C 2: 157,976,277 (GRCm39) Y149C probably damaging Het
Tmem151a C A 19: 5,132,895 (GRCm39) A104S probably damaging Het
Top1mt A G 15: 75,538,100 (GRCm39) probably null Het
Tpgs1 T A 10: 79,511,428 (GRCm39) L190Q possibly damaging Het
Triobp T A 15: 78,851,428 (GRCm39) H527Q possibly damaging Het
Tspan2 A G 3: 102,676,193 (GRCm39) I197V probably damaging Het
Ube3b A G 5: 114,525,506 (GRCm39) I76V probably benign Het
Vmn1r32 A T 6: 66,530,285 (GRCm39) S164T probably benign Het
Zfp607a G T 7: 27,577,884 (GRCm39) C318F probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGATCCATATTGGGGCTTTGCTGTC -3'
(R):5'- GGTGACCGGCTTTGTCTAAAATTATGC -3'

Sequencing Primer
(F):5'- GGTCCTTGCAGAATTCATCAG -3'
(R):5'- TGCATCAATGAATGTTACAGAAAAG -3'
Posted On 2014-05-23