Incidental Mutation 'R1732:Dmxl1'
ID 199432
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 039764-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R1732 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 50026511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1873 (L1873*)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000041772
AA Change: L1873*
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: L1873*

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000180611
AA Change: L1873*
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: L1873*

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181907
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,265,995 (GRCm39) Q1445K probably benign Het
Acacb A T 5: 114,328,148 (GRCm39) M303L possibly damaging Het
Actl9 T C 17: 33,652,096 (GRCm39) V52A probably damaging Het
Adam7 T C 14: 68,735,899 (GRCm39) T781A probably benign Het
Agpat4 T C 17: 12,435,615 (GRCm39) V293A probably benign Het
Ank1 T A 8: 23,601,479 (GRCm39) probably benign Het
Atp1a1 C A 3: 101,492,115 (GRCm39) G587V probably damaging Het
Avpr1b T C 1: 131,527,992 (GRCm39) F172L probably damaging Het
Bmp1 A T 14: 70,723,705 (GRCm39) D710E possibly damaging Het
Cep126 A T 9: 8,099,762 (GRCm39) I924N probably benign Het
Chek2 G T 5: 111,019,968 (GRCm39) A517S probably benign Het
Cmbl A T 15: 31,588,378 (GRCm39) E165D probably damaging Het
Cntnap3 A T 13: 64,888,626 (GRCm39) probably null Het
Col1a1 A T 11: 94,835,241 (GRCm39) probably benign Het
Ctbp2 T C 7: 132,600,653 (GRCm39) M624V possibly damaging Het
Cwc15 A G 9: 14,421,543 (GRCm39) D203G probably benign Het
Cyld C T 8: 89,458,295 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,302,455 (GRCm39) I84F probably damaging Het
Dennd3 T A 15: 73,409,267 (GRCm39) probably benign Het
Desi2 A C 1: 178,084,217 (GRCm39) probably benign Het
Ephb4 A G 5: 137,370,440 (GRCm39) N880S possibly damaging Het
F10 T C 8: 13,100,764 (GRCm39) L214P probably damaging Het
F5 G A 1: 164,001,719 (GRCm39) V141M probably damaging Het
Fam135a A T 1: 24,065,734 (GRCm39) S1022T possibly damaging Het
Fam13b A T 18: 34,620,187 (GRCm39) N232K probably benign Het
Fyco1 T C 9: 123,648,157 (GRCm39) E1259G probably benign Het
Gak A T 5: 108,724,448 (GRCm39) D1087E probably benign Het
Gm7138 A T 10: 77,612,682 (GRCm39) probably benign Het
Gm8674 T A 13: 50,055,962 (GRCm39) noncoding transcript Het
Gpr25 A G 1: 136,187,866 (GRCm39) V249A probably benign Het
Hcn3 T C 3: 89,055,426 (GRCm39) H607R probably damaging Het
Hdac4 T A 1: 91,875,257 (GRCm39) T905S probably benign Het
Itgad T C 7: 127,804,279 (GRCm39) S86P probably benign Het
Itgb4 G T 11: 115,879,744 (GRCm39) R632L probably damaging Het
Kcnb2 A T 1: 15,779,979 (GRCm39) T284S probably benign Het
Klhl22 T A 16: 17,594,888 (GRCm39) M339K probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mybpc2 C A 7: 44,163,099 (GRCm39) V484L probably benign Het
Noa1 A T 5: 77,454,221 (GRCm39) V473E probably benign Het
Nwd1 C G 8: 73,393,463 (GRCm39) S242C possibly damaging Het
Or55b10 C A 7: 102,143,247 (GRCm39) C245F probably damaging Het
Or7e174 A G 9: 20,012,796 (GRCm39) H247R probably damaging Het
Otof A T 5: 30,543,815 (GRCm39) W535R probably damaging Het
Peg3 T C 7: 6,712,084 (GRCm39) E1046G possibly damaging Het
Phldb2 T C 16: 45,577,529 (GRCm39) E1132G probably damaging Het
Phtf2 A T 5: 20,994,625 (GRCm39) probably null Het
Plce1 G T 19: 38,705,282 (GRCm39) A896S possibly damaging Het
Prim1 T C 10: 127,851,193 (GRCm39) Y26H probably damaging Het
Prr12 T A 7: 44,697,780 (GRCm39) T712S unknown Het
Psme4 G A 11: 30,798,105 (GRCm39) R1366H probably benign Het
Ptpdc1 T C 13: 48,740,021 (GRCm39) E409G probably benign Het
Rabep1 A G 11: 70,795,467 (GRCm39) N274S probably damaging Het
Rbm14 A G 19: 4,853,495 (GRCm39) S296P probably benign Het
Rec114 A G 9: 58,560,389 (GRCm39) S206P probably damaging Het
Rps6ka1 A T 4: 133,587,381 (GRCm39) Y531N probably damaging Het
Slc28a2 T C 2: 122,280,239 (GRCm39) probably benign Het
Slc34a1 A G 13: 55,561,233 (GRCm39) H566R probably benign Het
Slc9c1 A G 16: 45,373,291 (GRCm39) T290A probably benign Het
Smarcc1 T A 9: 110,014,888 (GRCm39) probably benign Het
Srp54b T A 12: 55,299,544 (GRCm39) probably null Het
Stambpl1 C G 19: 34,204,121 (GRCm39) N70K probably damaging Het
Synj1 T C 16: 90,761,118 (GRCm39) K710E probably damaging Het
Tenm3 T A 8: 48,763,669 (GRCm39) D795V probably damaging Het
Tgm2 T C 2: 157,976,277 (GRCm39) Y149C probably damaging Het
Tmem151a C A 19: 5,132,895 (GRCm39) A104S probably damaging Het
Top1mt A G 15: 75,538,100 (GRCm39) probably null Het
Tpgs1 T A 10: 79,511,428 (GRCm39) L190Q possibly damaging Het
Triobp T A 15: 78,851,428 (GRCm39) H527Q possibly damaging Het
Tspan2 A G 3: 102,676,193 (GRCm39) I197V probably damaging Het
Ube3b A G 5: 114,525,506 (GRCm39) I76V probably benign Het
Vmn1r32 A T 6: 66,530,285 (GRCm39) S164T probably benign Het
Zfp607a G T 7: 27,577,884 (GRCm39) C318F probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCCTCTGAGAGCAAGGGGACTC -3'
(R):5'- AGACCATTTGTCAGCGACGGTG -3'

Sequencing Primer
(F):5'- AGCAAGGGGACTCTTATGATTAC -3'
(R):5'- ACGGTGACCAGTCAGCAG -3'
Posted On 2014-05-23