Mutagenetix > Incidental Mutation

Incidental Mutation 'R1733:Col5a2'

199439

Institutional Source

Beutler Lab

Gene Symbol

Col5a2

Ensembl Gene

ENSMUSG00000026042

Gene Name

collagen, type V, alpha 2

Synonyms

1110014L14Rik

MMRRC Submission

039765-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1733 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45374321-45503282 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45407032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 462 (R462Q)

Ref Sequence

ENSEMBL: ENSMUSP00000083620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086430]

AlphaFold

Q3U962

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086430
AA Change: R462Q

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: R462Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VWC	40	95	9.94e-23	SMART
Pfam:Collagen	123	186	1.5e-10	PFAM
Pfam:Collagen	207	272	2.9e-9	PFAM
low complexity region	319	347	N/A	INTRINSIC
internal_repeat_1	349	421	3.18e-18	PROSPERO
internal_repeat_2	385	422	1.34e-12	PROSPERO
internal_repeat_5	388	423	1.55e-7	PROSPERO
low complexity region	424	460	N/A	INTRINSIC
low complexity region	471	508	N/A	INTRINSIC
internal_repeat_6	509	535	5.68e-7	PROSPERO
internal_repeat_2	511	548	1.34e-12	PROSPERO
internal_repeat_3	520	549	1.16e-11	PROSPERO
internal_repeat_1	520	571	3.18e-18	PROSPERO
internal_repeat_4	546	574	4.91e-9	PROSPERO
low complexity region	595	611	N/A	INTRINSIC
internal_repeat_7	616	741	1.35e-6	PROSPERO
low complexity region	742	757	N/A	INTRINSIC
Pfam:Collagen	790	870	4.8e-8	PFAM
low complexity region	877	898	N/A	INTRINSIC
Pfam:Collagen	907	979	4.2e-8	PFAM
internal_repeat_4	993	1021	4.91e-9	PROSPERO
internal_repeat_3	994	1023	1.16e-11	PROSPERO
low complexity region	1024	1054	N/A	INTRINSIC
internal_repeat_6	1055	1078	5.68e-7	PROSPERO
low complexity region	1081	1096	N/A	INTRINSIC
Pfam:Collagen	1111	1171	9.7e-12	PFAM
Pfam:Collagen	1168	1230	1.4e-9	PFAM
COLFI	1263	1497	1.83e-164	SMART

Meta Mutation Damage Score

0.1518

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 91.9%

Validation Efficiency

95% (95/100)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	G	18: 59,031,929	C1034W	probably damaging	Het
Agbl2	G	T	2: 90,810,745	K737N	probably damaging	Het
Aqp9	T	A	9: 71,112,342	I279F	possibly damaging	Het
Aspm	T	A	1: 139,457,117	N166K	probably benign	Het
Atp13a3	A	T	16: 30,357,266	I186N	probably benign	Het
Btaf1	A	T	19: 36,994,962	I1366L	probably benign	Het
Camk4	A	C	18: 33,078,021	K60Q	possibly damaging	Het
Card11	G	T	5: 140,906,633	Q226K	possibly damaging	Het
Ccdc187	T	C	2: 26,293,658	D110G	possibly damaging	Het
Cp	A	T	3: 19,968,219		probably benign	Het
Cpz	A	T	5: 35,517,758	V38E	probably damaging	Het
Cxcr6	G	A	9: 123,810,116	V68I	probably damaging	Het
Cyp2a22	C	A	7: 26,934,762	E322D	possibly damaging	Het
D130052B06Rik	C	T	11: 33,623,784	T127I	probably benign	Het
Daam2	T	A	17: 49,490,203	M185L	possibly damaging	Het
Dnaja3	G	A	16: 4,684,165	R11K	probably null	Het
Dnttip2	T	A	3: 122,276,748	S537R	probably benign	Het
Dock9	G	T	14: 121,626,880	H572Q	probably benign	Het
Dpp4	T	A	2: 62,372,869		probably null	Het
Enc1	T	G	13: 97,245,042	I20S	possibly damaging	Het
Ephb6	T	A	6: 41,619,720	H900Q	probably benign	Het
Ercc3	T	C	18: 32,267,165	V690A	possibly damaging	Het
Fam90a1a	C	T	8: 21,963,369	Q247*	probably null	Het
Fkbp10	G	A	11: 100,423,931	R423H	probably benign	Het
Fus	A	G	7: 127,981,545	M265V	probably benign	Het
Gas2l3	T	A	10: 89,414,265	K330N	probably damaging	Het
Gpam	T	G	19: 55,081,469	L410F	probably damaging	Het
Gpr37l1	A	T	1: 135,161,535	V264E	possibly damaging	Het
Grk6	A	T	13: 55,453,166		probably benign	Het
Gsto1	G	T	19: 47,855,235	V19F	probably damaging	Het
H1fnt	G	T	15: 98,256,135	Q378K	unknown	Het
Hgfac	G	A	5: 35,043,674	C194Y	probably damaging	Het
Hivep1	A	G	13: 42,157,931	N1216D	probably damaging	Het
Hrg	C	T	16: 22,951,247	A42V	probably damaging	Het
Irx4	A	G	13: 73,266,705	D136G	probably benign	Het
Kcnn3	G	T	3: 89,652,090	V556L	probably benign	Het
Klk8	T	C	7: 43,802,121	Y179H	possibly damaging	Het
Klrb1f	T	A	6: 129,054,359	L173*	probably null	Het
Kremen2	A	T	17: 23,743,399		probably null	Het
Krt25	A	T	11: 99,316,552	Y400*	probably null	Het
Lingo4	A	T	3: 94,403,178	R474S	probably benign	Het
Lnpep	T	C	17: 17,553,313	K599E	probably benign	Het
Mapk8ip3	A	T	17: 24,936,850	M2K	possibly damaging	Het
Mat2b	A	T	11: 40,680,077	S307T	probably benign	Het
Mcph1	C	A	8: 18,631,963	A372D	probably benign	Het
Mfsd6	T	A	1: 52,709,365	I114F	probably damaging	Het
Mlkl	A	G	8: 111,322,748	S248P	probably damaging	Het
Mmrn1	A	T	6: 60,977,101	T789S	probably benign	Het
Mphosph8	A	G	14: 56,693,459	Y735C	probably damaging	Het
Mrc1	T	A	2: 14,257,099	Y300N	probably damaging	Het
Mrps11	A	G	7: 78,792,712	H180R	probably damaging	Het
Msh4	T	C	3: 153,867,767	D556G	probably damaging	Het
Myh10	C	A	11: 68,802,296	D1472E	probably benign	Het
Myo16	T	C	8: 10,442,283	S742P	probably damaging	Het
Nlrp5-ps	C	T	7: 14,583,053		noncoding transcript	Het
Nrp1	C	T	8: 128,468,493	P477S	probably benign	Het
Olfr1278	T	C	2: 111,292,865	V199A	probably damaging	Het
Olfr1307	T	A	2: 111,945,280	M59L	probably benign	Het
Olfr64	T	C	7: 103,892,911	S275G	probably benign	Het
Olfr936	G	T	9: 39,047,382	H57N	unknown	Het
Oplah	G	T	15: 76,302,483	C665*	probably null	Het
Otogl	T	C	10: 107,783,712	T1696A	possibly damaging	Het
Pdzrn4	A	G	15: 92,401,974	I242V	probably benign	Het
Phgdh	G	A	3: 98,328,135	T141I	probably benign	Het
Pigv	T	C	4: 133,664,926	Y311C	probably damaging	Het
Pik3c2a	T	G	7: 116,418,520	M1L	possibly damaging	Het
Pitpnm1	A	T	19: 4,109,960	K760*	probably null	Het
Pnrc1	G	A	4: 33,246,438	H174Y	probably damaging	Het
Ptgis	A	G	2: 167,191,968		probably benign	Het
Ptpn4	T	C	1: 119,716,043		probably null	Het
Rin3	T	A	12: 102,369,330	L420*	probably null	Het
Sacs	T	G	14: 61,205,454	F1650V	probably damaging	Het
Sbno2	T	A	10: 80,058,508	N1081Y	possibly damaging	Het
Sema5b	C	T	16: 35,646,367	P213L	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint6	T	A	4: 113,177,037		probably benign	Het
Slc4a2	A	G	5: 24,429,567	E68G	probably damaging	Het
Srcin1	C	T	11: 97,533,501	V634I	probably benign	Het
Srsf10	T	A	4: 135,863,165	F134I	possibly damaging	Het
Stab1	C	A	14: 31,145,303	G1700V	probably damaging	Het
Sun1	T	G	5: 139,230,789	C290W	possibly damaging	Het
Svs6	T	A	2: 164,317,657		probably benign	Het
Tmem8b	G	A	4: 43,690,228		probably null	Het
Usp49	A	G	17: 47,672,313	D81G	probably damaging	Het
Vmn1r215	T	A	13: 23,076,678	V296D	probably benign	Het
Vmn1r6	T	A	6: 57,002,622	S90T	probably damaging	Het
Wbp2	A	G	11: 116,083,883	F42L	probably benign	Het
Wdr20rt	C	T	12: 65,227,281	T333I	possibly damaging	Het
Zfp341	C	T	2: 154,641,378	A552V	probably benign	Het
Zfp607b	A	T	7: 27,692,524	H8L	possibly damaging	Het
Zfp758	G	T	17: 22,375,849	D439Y	probably damaging	Het
Zfp946	T	C	17: 22,453,557	Y46H	probably damaging	Het
Zic2	G	A	14: 122,478,947	E432K	probably damaging	Het

Other mutations in Col5a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Col5a2	APN	1	45392877	splice site	probably benign
IGL00978:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01366:Col5a2	APN	1	45391888	missense	possibly damaging	0.46
IGL01487:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01820:Col5a2	APN	1	45442825	missense	unknown
IGL01980:Col5a2	APN	1	45382233	splice site	probably benign
IGL02063:Col5a2	APN	1	45403419	critical splice donor site	probably null
IGL02134:Col5a2	APN	1	45391070	splice site	probably null
IGL02233:Col5a2	APN	1	45383587	splice site	probably null
IGL02489:Col5a2	APN	1	45392811	splice site	probably null
IGL02928:Col5a2	APN	1	45385020	missense	probably benign	0.41
IGL02931:Col5a2	APN	1	45385065	missense	probably damaging	1.00
IGL03328:Col5a2	APN	1	45376146	missense	possibly damaging	0.94
Beatnik	UTSW	1	45376778	missense	probably damaging	0.99
R0022:Col5a2	UTSW	1	45383683	nonsense	probably null
R0123:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0180:Col5a2	UTSW	1	45411460	missense	probably damaging	1.00
R0225:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0455:Col5a2	UTSW	1	45382102	splice site	probably benign
R0485:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R0702:Col5a2	UTSW	1	45380131	missense	possibly damaging	0.54
R0745:Col5a2	UTSW	1	45407227	splice site	probably null
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1394:Col5a2	UTSW	1	45403419	critical splice donor site	probably null
R1494:Col5a2	UTSW	1	45502914	start codon destroyed	unknown
R1499:Col5a2	UTSW	1	45411466	missense	probably benign	0.00
R1789:Col5a2	UTSW	1	45378305	critical splice donor site	probably null
R1789:Col5a2	UTSW	1	45394776	missense	probably damaging	0.98
R2114:Col5a2	UTSW	1	45376804	missense	probably damaging	0.98
R2915:Col5a2	UTSW	1	45413496	missense	probably damaging	1.00
R3861:Col5a2	UTSW	1	45380237	missense	probably damaging	0.98
R4015:Col5a2	UTSW	1	45403471	missense	probably benign	0.14
R4944:Col5a2	UTSW	1	45376695	missense	possibly damaging	0.75
R4982:Col5a2	UTSW	1	45389458	missense	possibly damaging	0.88
R5001:Col5a2	UTSW	1	45502898	missense	unknown
R5159:Col5a2	UTSW	1	45386831	critical splice donor site	probably null
R5197:Col5a2	UTSW	1	45393081	missense	probably benign	0.01
R5407:Col5a2	UTSW	1	45406280	missense	possibly damaging	0.54
R5502:Col5a2	UTSW	1	45380126	missense	probably damaging	1.00
R5575:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R5622:Col5a2	UTSW	1	45427059	missense	probably benign
R5643:Col5a2	UTSW	1	45390042	missense	probably damaging	1.00
R5801:Col5a2	UTSW	1	45389481	critical splice acceptor site	probably null
R6075:Col5a2	UTSW	1	45502848	missense	unknown
R6211:Col5a2	UTSW	1	45376666	missense	probably damaging	0.99
R6407:Col5a2	UTSW	1	45376778	missense	probably damaging	0.99
R6494:Col5a2	UTSW	1	45378327	missense	probably damaging	0.99
R6582:Col5a2	UTSW	1	45390115	missense	possibly damaging	0.91
R6687:Col5a2	UTSW	1	45383604	missense	probably damaging	1.00
R7007:Col5a2	UTSW	1	45378449	missense	possibly damaging	0.53
R7062:Col5a2	UTSW	1	45417625	missense	probably benign	0.00
R7098:Col5a2	UTSW	1	45380067	missense	possibly damaging	0.48
R7243:Col5a2	UTSW	1	45376160	missense	probably benign	0.39
R7326:Col5a2	UTSW	1	45442867	missense	unknown
R7332:Col5a2	UTSW	1	45380165	missense	probably damaging	1.00
R7642:Col5a2	UTSW	1	45376088	missense	probably benign	0.01
R7890:Col5a2	UTSW	1	45404987	splice site	probably null
R8066:Col5a2	UTSW	1	45413468	critical splice donor site	probably null
R8375:Col5a2	UTSW	1	45442730	missense	unknown
R8444:Col5a2	UTSW	1	45396145	missense	probably benign	0.06
R8506:Col5a2	UTSW	1	45442784	missense	unknown
R8686:Col5a2	UTSW	1	45421987	missense	probably damaging	1.00
R8907:Col5a2	UTSW	1	45416946	missense	probably benign	0.27
R8932:Col5a2	UTSW	1	45380146	missense	probably benign	0.00
R8933:Col5a2	UTSW	1	45421963	missense
R9087:Col5a2	UTSW	1	45442658	missense	unknown
R9105:Col5a2	UTSW	1	45380206	missense	probably benign	0.00
R9282:Col5a2	UTSW	1	45438869	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45386844	missense	probably benign	0.00
R9457:Col5a2	UTSW	1	45392813	critical splice donor site	probably null
R9568:Col5a2	UTSW	1	45391838	missense	possibly damaging	0.89
R9727:Col5a2	UTSW	1	45376658	missense	possibly damaging	0.50
X0013:Col5a2	UTSW	1	45403258	critical splice donor site	probably null
Z1176:Col5a2	UTSW	1	45376146	missense	possibly damaging	0.94
Z1176:Col5a2	UTSW	1	45383680	missense	probably damaging	1.00
Z1176:Col5a2	UTSW	1	45396484	missense	probably benign	0.11
Z1177:Col5a2	UTSW	1	45402113	missense	probably damaging	1.00
Z1177:Col5a2	UTSW	1	45403473	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACCTCCCAAGCTCTAGGATTAGAAG -3'
(R):5'- GCCCCACAGTAAGTACCAGAACTTATG -3'

Sequencing Primer
(F):5'- CTCTAGGATTAGAAGCATGGTCCTC -3'
(R):5'- CAGTAAGTACCAGAACTTATGTCAGG -3'

Posted On

2014-05-23