Incidental Mutation 'R1733:Ccdc187'
ID 199446
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission 039765-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R1733 (G1)
Quality Score 127
Status Validated
Chromosome 2
Chromosomal Location 26161659-26184569 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26183670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect possibly damaging
Transcript: ENSMUST00000057224
AA Change: D110G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: D110G

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: D110G
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: D110G
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,165,001 (GRCm39) C1034W probably damaging Het
Agbl2 G T 2: 90,641,089 (GRCm39) K737N probably damaging Het
Aqp9 T A 9: 71,019,624 (GRCm39) I279F possibly damaging Het
Aspm T A 1: 139,384,855 (GRCm39) N166K probably benign Het
Atp13a3 A T 16: 30,176,084 (GRCm39) I186N probably benign Het
Btaf1 A T 19: 36,972,362 (GRCm39) I1366L probably benign Het
Camk4 A C 18: 33,211,074 (GRCm39) K60Q possibly damaging Het
Card11 G T 5: 140,892,388 (GRCm39) Q226K possibly damaging Het
Col5a2 C T 1: 45,446,192 (GRCm39) R462Q possibly damaging Het
Cp A T 3: 20,022,383 (GRCm39) probably benign Het
Cpz A T 5: 35,675,102 (GRCm39) V38E probably damaging Het
Cxcr6 G A 9: 123,639,181 (GRCm39) V68I probably damaging Het
Cyp2a22 C A 7: 26,634,187 (GRCm39) E322D possibly damaging Het
D130052B06Rik C T 11: 33,573,784 (GRCm39) T127I probably benign Het
Daam2 T A 17: 49,797,231 (GRCm39) M185L possibly damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Dnttip2 T A 3: 122,070,397 (GRCm39) S537R probably benign Het
Dock9 G T 14: 121,864,292 (GRCm39) H572Q probably benign Het
Dpp4 T A 2: 62,203,213 (GRCm39) probably null Het
Enc1 T G 13: 97,381,550 (GRCm39) I20S possibly damaging Het
Ephb6 T A 6: 41,596,654 (GRCm39) H900Q probably benign Het
Ercc3 T C 18: 32,400,218 (GRCm39) V690A possibly damaging Het
Fam90a1a C T 8: 22,453,385 (GRCm39) Q247* probably null Het
Fkbp10 G A 11: 100,314,757 (GRCm39) R423H probably benign Het
Fus A G 7: 127,580,717 (GRCm39) M265V probably benign Het
Gas2l3 T A 10: 89,250,127 (GRCm39) K330N probably damaging Het
Gpam T G 19: 55,069,901 (GRCm39) L410F probably damaging Het
Gpr37l1 A T 1: 135,089,273 (GRCm39) V264E possibly damaging Het
Grk6 A T 13: 55,600,979 (GRCm39) probably benign Het
Gsto1 G T 19: 47,843,674 (GRCm39) V19F probably damaging Het
H1f7 G T 15: 98,154,016 (GRCm39) Q378K unknown Het
Hgfac G A 5: 35,201,018 (GRCm39) C194Y probably damaging Het
Hivep1 A G 13: 42,311,407 (GRCm39) N1216D probably damaging Het
Hrg C T 16: 22,769,997 (GRCm39) A42V probably damaging Het
Irx4 A G 13: 73,414,824 (GRCm39) D136G probably benign Het
Kcnn3 G T 3: 89,559,397 (GRCm39) V556L probably benign Het
Klk1b8 T C 7: 43,451,545 (GRCm39) Y179H possibly damaging Het
Klrb1f T A 6: 129,031,322 (GRCm39) L173* probably null Het
Kremen2 A T 17: 23,962,373 (GRCm39) probably null Het
Krt25 A T 11: 99,207,378 (GRCm39) Y400* probably null Het
Lingo4 A T 3: 94,310,485 (GRCm39) R474S probably benign Het
Lnpep T C 17: 17,773,575 (GRCm39) K599E probably benign Het
Mapk8ip3 A T 17: 25,155,824 (GRCm39) M2K possibly damaging Het
Mat2b A T 11: 40,570,904 (GRCm39) S307T probably benign Het
Mcph1 C A 8: 18,681,979 (GRCm39) A372D probably benign Het
Mfsd6 T A 1: 52,748,524 (GRCm39) I114F probably damaging Het
Mlkl A G 8: 112,049,380 (GRCm39) S248P probably damaging Het
Mmrn1 A T 6: 60,954,085 (GRCm39) T789S probably benign Het
Mphosph8 A G 14: 56,930,916 (GRCm39) Y735C probably damaging Het
Mrc1 T A 2: 14,261,910 (GRCm39) Y300N probably damaging Het
Mrps11 A G 7: 78,442,460 (GRCm39) H180R probably damaging Het
Msh4 T C 3: 153,573,404 (GRCm39) D556G probably damaging Het
Myh10 C A 11: 68,693,122 (GRCm39) D1472E probably benign Het
Myo16 T C 8: 10,492,283 (GRCm39) S742P probably damaging Het
Nlrp5-ps C T 7: 14,316,978 (GRCm39) noncoding transcript Het
Nrp1 C T 8: 129,194,974 (GRCm39) P477S probably benign Het
Oplah G T 15: 76,186,683 (GRCm39) C665* probably null Het
Or4f14b T A 2: 111,775,625 (GRCm39) M59L probably benign Het
Or4f54 T C 2: 111,123,210 (GRCm39) V199A probably damaging Het
Or51b17 T C 7: 103,542,118 (GRCm39) S275G probably benign Het
Or8g22 G T 9: 38,958,678 (GRCm39) H57N unknown Het
Otogl T C 10: 107,619,573 (GRCm39) T1696A possibly damaging Het
Pdzrn4 A G 15: 92,299,855 (GRCm39) I242V probably benign Het
Phgdh G A 3: 98,235,451 (GRCm39) T141I probably benign Het
Pigv T C 4: 133,392,237 (GRCm39) Y311C probably damaging Het
Pik3c2a T G 7: 116,017,755 (GRCm39) M1L possibly damaging Het
Pitpnm1 A T 19: 4,159,960 (GRCm39) K760* probably null Het
Pnrc1 G A 4: 33,246,438 (GRCm39) H174Y probably damaging Het
Ptgis A G 2: 167,033,888 (GRCm39) probably benign Het
Ptpn4 T C 1: 119,643,773 (GRCm39) probably null Het
Rin3 T A 12: 102,335,589 (GRCm39) L420* probably null Het
Sacs T G 14: 61,442,903 (GRCm39) F1650V probably damaging Het
Sbno2 T A 10: 79,894,342 (GRCm39) N1081Y possibly damaging Het
Sema5b C T 16: 35,466,737 (GRCm39) P213L probably damaging Het
Sharpin T C 15: 76,232,136 (GRCm39) K240R probably benign Het
Skint6 T A 4: 113,034,234 (GRCm39) probably benign Het
Slc4a2 A G 5: 24,634,565 (GRCm39) E68G probably damaging Het
Srcin1 C T 11: 97,424,327 (GRCm39) V634I probably benign Het
Srsf10 T A 4: 135,590,476 (GRCm39) F134I possibly damaging Het
Stab1 C A 14: 30,867,260 (GRCm39) G1700V probably damaging Het
Sun1 T G 5: 139,216,544 (GRCm39) C290W possibly damaging Het
Svs6 T A 2: 164,159,577 (GRCm39) probably benign Het
Tmem8b G A 4: 43,690,228 (GRCm39) probably null Het
Usp49 A G 17: 47,983,238 (GRCm39) D81G probably damaging Het
Vmn1r215 T A 13: 23,260,848 (GRCm39) V296D probably benign Het
Vmn1r6 T A 6: 56,979,607 (GRCm39) S90T probably damaging Het
Wbp2 A G 11: 115,974,709 (GRCm39) F42L probably benign Het
Wdr20rt C T 12: 65,274,055 (GRCm39) T333I possibly damaging Het
Zfp341 C T 2: 154,483,298 (GRCm39) A552V probably benign Het
Zfp607b A T 7: 27,391,949 (GRCm39) H8L possibly damaging Het
Zfp758 G T 17: 22,594,830 (GRCm39) D439Y probably damaging Het
Zfp946 T C 17: 22,672,538 (GRCm39) Y46H probably damaging Het
Zic2 G A 14: 122,716,359 (GRCm39) E432K probably damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26,170,960 (GRCm39) missense probably benign
IGL02989:Ccdc187 APN 2 26,166,443 (GRCm39) missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26,170,978 (GRCm39) missense probably benign
IGL03059:Ccdc187 APN 2 26,184,253 (GRCm39) missense probably null 1.00
IGL03117:Ccdc187 APN 2 26,177,980 (GRCm39) missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26,171,365 (GRCm39) missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26,184,389 (GRCm39) missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26,166,133 (GRCm39) missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26,171,087 (GRCm39) missense probably benign
R1851:Ccdc187 UTSW 2 26,166,080 (GRCm39) missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26,171,029 (GRCm39) missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26,172,239 (GRCm39) intron probably benign
R4344:Ccdc187 UTSW 2 26,170,681 (GRCm39) missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26,183,451 (GRCm39) missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26,166,237 (GRCm39) missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26,183,380 (GRCm39) missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26,183,593 (GRCm39) missense probably benign
R6261:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26,179,791 (GRCm39) missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26,179,746 (GRCm39) missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26,179,731 (GRCm39) missense probably benign
R7006:Ccdc187 UTSW 2 26,171,102 (GRCm39) missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26,146,007 (GRCm39) missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26,166,186 (GRCm39) missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26,183,526 (GRCm39) missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26,170,630 (GRCm39) missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26,171,548 (GRCm39) missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26,183,814 (GRCm39) missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26,165,505 (GRCm39) missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26,170,526 (GRCm39) missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26,171,079 (GRCm39) missense probably benign
R9214:Ccdc187 UTSW 2 26,183,409 (GRCm39) missense probably benign 0.19
R9454:Ccdc187 UTSW 2 26,166,114 (GRCm39) missense possibly damaging 0.94
R9542:Ccdc187 UTSW 2 26,145,930 (GRCm39) missense possibly damaging 0.66
R9562:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9565:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9601:Ccdc187 UTSW 2 26,143,445 (GRCm39) missense possibly damaging 0.90
R9702:Ccdc187 UTSW 2 26,172,222 (GRCm39) missense unknown
R9727:Ccdc187 UTSW 2 26,171,204 (GRCm39) missense probably damaging 0.99
R9790:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
R9791:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
Z1176:Ccdc187 UTSW 2 26,171,519 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGGAAGCGCATTTGTCACCTTG -3'
(R):5'- AGTGTTCCATCCACATGCAGCC -3'

Sequencing Primer
(F):5'- GGGTCTTCCGCCATAGCATC -3'
(R):5'- AGCCAAGGACAGCCTTCTG -3'
Posted On 2014-05-23