Incidental Mutation 'R1733:Or51b17'
ID 199485
Institutional Source Beutler Lab
Gene Symbol Or51b17
Ensembl Gene ENSMUSG00000063615
Gene Name olfactory receptor family 51 subfamily B member 17
Synonyms GA_x6K02T2PBJ9-6648196-6649143, Olfr64, 5'[b]2, MOR1-2
MMRRC Submission 039765-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R1733 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103542017-103543678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103542118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 275 (S275G)
Ref Sequence ENSEMBL: ENSMUSP00000080444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081748]
AlphaFold F8VPZ8
Predicted Effect probably benign
Transcript: ENSMUST00000081748
AA Change: S275G

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080444
Gene: ENSMUSG00000063615
AA Change: S275G

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 33 295 4.2e-6 PFAM
Pfam:7tm_1 39 290 1.1e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,165,001 (GRCm39) C1034W probably damaging Het
Agbl2 G T 2: 90,641,089 (GRCm39) K737N probably damaging Het
Aqp9 T A 9: 71,019,624 (GRCm39) I279F possibly damaging Het
Aspm T A 1: 139,384,855 (GRCm39) N166K probably benign Het
Atp13a3 A T 16: 30,176,084 (GRCm39) I186N probably benign Het
Btaf1 A T 19: 36,972,362 (GRCm39) I1366L probably benign Het
Camk4 A C 18: 33,211,074 (GRCm39) K60Q possibly damaging Het
Card11 G T 5: 140,892,388 (GRCm39) Q226K possibly damaging Het
Ccdc187 T C 2: 26,183,670 (GRCm39) D110G possibly damaging Het
Col5a2 C T 1: 45,446,192 (GRCm39) R462Q possibly damaging Het
Cp A T 3: 20,022,383 (GRCm39) probably benign Het
Cpz A T 5: 35,675,102 (GRCm39) V38E probably damaging Het
Cxcr6 G A 9: 123,639,181 (GRCm39) V68I probably damaging Het
Cyp2a22 C A 7: 26,634,187 (GRCm39) E322D possibly damaging Het
D130052B06Rik C T 11: 33,573,784 (GRCm39) T127I probably benign Het
Daam2 T A 17: 49,797,231 (GRCm39) M185L possibly damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Dnttip2 T A 3: 122,070,397 (GRCm39) S537R probably benign Het
Dock9 G T 14: 121,864,292 (GRCm39) H572Q probably benign Het
Dpp4 T A 2: 62,203,213 (GRCm39) probably null Het
Enc1 T G 13: 97,381,550 (GRCm39) I20S possibly damaging Het
Ephb6 T A 6: 41,596,654 (GRCm39) H900Q probably benign Het
Ercc3 T C 18: 32,400,218 (GRCm39) V690A possibly damaging Het
Fam90a1a C T 8: 22,453,385 (GRCm39) Q247* probably null Het
Fkbp10 G A 11: 100,314,757 (GRCm39) R423H probably benign Het
Fus A G 7: 127,580,717 (GRCm39) M265V probably benign Het
Gas2l3 T A 10: 89,250,127 (GRCm39) K330N probably damaging Het
Gpam T G 19: 55,069,901 (GRCm39) L410F probably damaging Het
Gpr37l1 A T 1: 135,089,273 (GRCm39) V264E possibly damaging Het
Grk6 A T 13: 55,600,979 (GRCm39) probably benign Het
Gsto1 G T 19: 47,843,674 (GRCm39) V19F probably damaging Het
H1f7 G T 15: 98,154,016 (GRCm39) Q378K unknown Het
Hgfac G A 5: 35,201,018 (GRCm39) C194Y probably damaging Het
Hivep1 A G 13: 42,311,407 (GRCm39) N1216D probably damaging Het
Hrg C T 16: 22,769,997 (GRCm39) A42V probably damaging Het
Irx4 A G 13: 73,414,824 (GRCm39) D136G probably benign Het
Kcnn3 G T 3: 89,559,397 (GRCm39) V556L probably benign Het
Klk1b8 T C 7: 43,451,545 (GRCm39) Y179H possibly damaging Het
Klrb1f T A 6: 129,031,322 (GRCm39) L173* probably null Het
Kremen2 A T 17: 23,962,373 (GRCm39) probably null Het
Krt25 A T 11: 99,207,378 (GRCm39) Y400* probably null Het
Lingo4 A T 3: 94,310,485 (GRCm39) R474S probably benign Het
Lnpep T C 17: 17,773,575 (GRCm39) K599E probably benign Het
Mapk8ip3 A T 17: 25,155,824 (GRCm39) M2K possibly damaging Het
Mat2b A T 11: 40,570,904 (GRCm39) S307T probably benign Het
Mcph1 C A 8: 18,681,979 (GRCm39) A372D probably benign Het
Mfsd6 T A 1: 52,748,524 (GRCm39) I114F probably damaging Het
Mlkl A G 8: 112,049,380 (GRCm39) S248P probably damaging Het
Mmrn1 A T 6: 60,954,085 (GRCm39) T789S probably benign Het
Mphosph8 A G 14: 56,930,916 (GRCm39) Y735C probably damaging Het
Mrc1 T A 2: 14,261,910 (GRCm39) Y300N probably damaging Het
Mrps11 A G 7: 78,442,460 (GRCm39) H180R probably damaging Het
Msh4 T C 3: 153,573,404 (GRCm39) D556G probably damaging Het
Myh10 C A 11: 68,693,122 (GRCm39) D1472E probably benign Het
Myo16 T C 8: 10,492,283 (GRCm39) S742P probably damaging Het
Nlrp5-ps C T 7: 14,316,978 (GRCm39) noncoding transcript Het
Nrp1 C T 8: 129,194,974 (GRCm39) P477S probably benign Het
Oplah G T 15: 76,186,683 (GRCm39) C665* probably null Het
Or4f14b T A 2: 111,775,625 (GRCm39) M59L probably benign Het
Or4f54 T C 2: 111,123,210 (GRCm39) V199A probably damaging Het
Or8g22 G T 9: 38,958,678 (GRCm39) H57N unknown Het
Otogl T C 10: 107,619,573 (GRCm39) T1696A possibly damaging Het
Pdzrn4 A G 15: 92,299,855 (GRCm39) I242V probably benign Het
Phgdh G A 3: 98,235,451 (GRCm39) T141I probably benign Het
Pigv T C 4: 133,392,237 (GRCm39) Y311C probably damaging Het
Pik3c2a T G 7: 116,017,755 (GRCm39) M1L possibly damaging Het
Pitpnm1 A T 19: 4,159,960 (GRCm39) K760* probably null Het
Pnrc1 G A 4: 33,246,438 (GRCm39) H174Y probably damaging Het
Ptgis A G 2: 167,033,888 (GRCm39) probably benign Het
Ptpn4 T C 1: 119,643,773 (GRCm39) probably null Het
Rin3 T A 12: 102,335,589 (GRCm39) L420* probably null Het
Sacs T G 14: 61,442,903 (GRCm39) F1650V probably damaging Het
Sbno2 T A 10: 79,894,342 (GRCm39) N1081Y possibly damaging Het
Sema5b C T 16: 35,466,737 (GRCm39) P213L probably damaging Het
Sharpin T C 15: 76,232,136 (GRCm39) K240R probably benign Het
Skint6 T A 4: 113,034,234 (GRCm39) probably benign Het
Slc4a2 A G 5: 24,634,565 (GRCm39) E68G probably damaging Het
Srcin1 C T 11: 97,424,327 (GRCm39) V634I probably benign Het
Srsf10 T A 4: 135,590,476 (GRCm39) F134I possibly damaging Het
Stab1 C A 14: 30,867,260 (GRCm39) G1700V probably damaging Het
Sun1 T G 5: 139,216,544 (GRCm39) C290W possibly damaging Het
Svs6 T A 2: 164,159,577 (GRCm39) probably benign Het
Tmem8b G A 4: 43,690,228 (GRCm39) probably null Het
Usp49 A G 17: 47,983,238 (GRCm39) D81G probably damaging Het
Vmn1r215 T A 13: 23,260,848 (GRCm39) V296D probably benign Het
Vmn1r6 T A 6: 56,979,607 (GRCm39) S90T probably damaging Het
Wbp2 A G 11: 115,974,709 (GRCm39) F42L probably benign Het
Wdr20rt C T 12: 65,274,055 (GRCm39) T333I possibly damaging Het
Zfp341 C T 2: 154,483,298 (GRCm39) A552V probably benign Het
Zfp607b A T 7: 27,391,949 (GRCm39) H8L possibly damaging Het
Zfp758 G T 17: 22,594,830 (GRCm39) D439Y probably damaging Het
Zfp946 T C 17: 22,672,538 (GRCm39) Y46H probably damaging Het
Zic2 G A 14: 122,716,359 (GRCm39) E432K probably damaging Het
Other mutations in Or51b17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Or51b17 APN 7 103,542,071 (GRCm39) nonsense probably null
IGL01597:Or51b17 APN 7 103,542,303 (GRCm39) missense probably benign 0.01
IGL01868:Or51b17 APN 7 103,542,583 (GRCm39) nonsense probably null
IGL02502:Or51b17 APN 7 103,542,696 (GRCm39) missense probably damaging 0.99
R0294:Or51b17 UTSW 7 103,542,137 (GRCm39) missense probably benign 0.09
R0534:Or51b17 UTSW 7 103,542,438 (GRCm39) missense probably benign 0.00
R0838:Or51b17 UTSW 7 103,542,622 (GRCm39) missense probably benign 0.00
R1350:Or51b17 UTSW 7 103,542,937 (GRCm39) missense probably benign 0.01
R1768:Or51b17 UTSW 7 103,542,484 (GRCm39) missense probably benign 0.28
R1780:Or51b17 UTSW 7 103,542,762 (GRCm39) missense probably damaging 1.00
R1836:Or51b17 UTSW 7 103,542,592 (GRCm39) missense probably damaging 0.98
R1956:Or51b17 UTSW 7 103,542,925 (GRCm39) missense probably benign 0.01
R2075:Or51b17 UTSW 7 103,542,127 (GRCm39) missense probably damaging 0.96
R4677:Or51b17 UTSW 7 103,542,615 (GRCm39) missense probably damaging 1.00
R4884:Or51b17 UTSW 7 103,542,862 (GRCm39) missense probably benign 0.04
R4899:Or51b17 UTSW 7 103,542,672 (GRCm39) missense possibly damaging 0.54
R5753:Or51b17 UTSW 7 103,542,408 (GRCm39) missense probably damaging 1.00
R6351:Or51b17 UTSW 7 103,542,342 (GRCm39) nonsense probably null
R6997:Or51b17 UTSW 7 103,542,238 (GRCm39) missense probably benign 0.00
R8319:Or51b17 UTSW 7 103,542,636 (GRCm39) missense probably damaging 1.00
R8337:Or51b17 UTSW 7 103,542,256 (GRCm39) missense probably benign
R8984:Or51b17 UTSW 7 103,542,816 (GRCm39) missense probably benign 0.01
R9780:Or51b17 UTSW 7 103,542,631 (GRCm39) missense probably damaging 0.99
X0017:Or51b17 UTSW 7 103,542,358 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTCACTAGCCCAGACTAGACAC -3'
(R):5'- TGAAGACAGTTATGGGCATTGCCTC -3'

Sequencing Primer
(F):5'- gataaacagatggacagatgatagag -3'
(R):5'- TCTGGAGAGGAGAGAAAAAAGTC -3'
Posted On 2014-05-23