Mutagenetix > Incidental Mutation

Incidental Mutation 'R1733:Pik3c2a'

199486

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

039765-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1733 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to G at 116418520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1 (M1L)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170430
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205378
AA Change: M1L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205767

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206219
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.7574

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 91.9%

Validation Efficiency

95% (95/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	G	18: 59,031,929	C1034W	probably damaging	Het
Agbl2	G	T	2: 90,810,745	K737N	probably damaging	Het
Aqp9	T	A	9: 71,112,342	I279F	possibly damaging	Het
Aspm	T	A	1: 139,457,117	N166K	probably benign	Het
Atp13a3	A	T	16: 30,357,266	I186N	probably benign	Het
Btaf1	A	T	19: 36,994,962	I1366L	probably benign	Het
Camk4	A	C	18: 33,078,021	K60Q	possibly damaging	Het
Card11	G	T	5: 140,906,633	Q226K	possibly damaging	Het
Ccdc187	T	C	2: 26,293,658	D110G	possibly damaging	Het
Col5a2	C	T	1: 45,407,032	R462Q	possibly damaging	Het
Cp	A	T	3: 19,968,219		probably benign	Het
Cpz	A	T	5: 35,517,758	V38E	probably damaging	Het
Cxcr6	G	A	9: 123,810,116	V68I	probably damaging	Het
Cyp2a22	C	A	7: 26,934,762	E322D	possibly damaging	Het
D130052B06Rik	C	T	11: 33,623,784	T127I	probably benign	Het
Daam2	T	A	17: 49,490,203	M185L	possibly damaging	Het
Dnaja3	G	A	16: 4,684,165	R11K	probably null	Het
Dnttip2	T	A	3: 122,276,748	S537R	probably benign	Het
Dock9	G	T	14: 121,626,880	H572Q	probably benign	Het
Dpp4	T	A	2: 62,372,869		probably null	Het
Enc1	T	G	13: 97,245,042	I20S	possibly damaging	Het
Ephb6	T	A	6: 41,619,720	H900Q	probably benign	Het
Ercc3	T	C	18: 32,267,165	V690A	possibly damaging	Het
Fam90a1a	C	T	8: 21,963,369	Q247*	probably null	Het
Fkbp10	G	A	11: 100,423,931	R423H	probably benign	Het
Fus	A	G	7: 127,981,545	M265V	probably benign	Het
Gas2l3	T	A	10: 89,414,265	K330N	probably damaging	Het
Gpam	T	G	19: 55,081,469	L410F	probably damaging	Het
Gpr37l1	A	T	1: 135,161,535	V264E	possibly damaging	Het
Grk6	A	T	13: 55,453,166		probably benign	Het
Gsto1	G	T	19: 47,855,235	V19F	probably damaging	Het
H1fnt	G	T	15: 98,256,135	Q378K	unknown	Het
Hgfac	G	A	5: 35,043,674	C194Y	probably damaging	Het
Hivep1	A	G	13: 42,157,931	N1216D	probably damaging	Het
Hrg	C	T	16: 22,951,247	A42V	probably damaging	Het
Irx4	A	G	13: 73,266,705	D136G	probably benign	Het
Kcnn3	G	T	3: 89,652,090	V556L	probably benign	Het
Klk8	T	C	7: 43,802,121	Y179H	possibly damaging	Het
Klrb1f	T	A	6: 129,054,359	L173*	probably null	Het
Kremen2	A	T	17: 23,743,399		probably null	Het
Krt25	A	T	11: 99,316,552	Y400*	probably null	Het
Lingo4	A	T	3: 94,403,178	R474S	probably benign	Het
Lnpep	T	C	17: 17,553,313	K599E	probably benign	Het
Mapk8ip3	A	T	17: 24,936,850	M2K	possibly damaging	Het
Mat2b	A	T	11: 40,680,077	S307T	probably benign	Het
Mcph1	C	A	8: 18,631,963	A372D	probably benign	Het
Mfsd6	T	A	1: 52,709,365	I114F	probably damaging	Het
Mlkl	A	G	8: 111,322,748	S248P	probably damaging	Het
Mmrn1	A	T	6: 60,977,101	T789S	probably benign	Het
Mphosph8	A	G	14: 56,693,459	Y735C	probably damaging	Het
Mrc1	T	A	2: 14,257,099	Y300N	probably damaging	Het
Mrps11	A	G	7: 78,792,712	H180R	probably damaging	Het
Msh4	T	C	3: 153,867,767	D556G	probably damaging	Het
Myh10	C	A	11: 68,802,296	D1472E	probably benign	Het
Myo16	T	C	8: 10,442,283	S742P	probably damaging	Het
Nlrp5-ps	C	T	7: 14,583,053		noncoding transcript	Het
Nrp1	C	T	8: 128,468,493	P477S	probably benign	Het
Olfr1278	T	C	2: 111,292,865	V199A	probably damaging	Het
Olfr1307	T	A	2: 111,945,280	M59L	probably benign	Het
Olfr64	T	C	7: 103,892,911	S275G	probably benign	Het
Olfr936	G	T	9: 39,047,382	H57N	unknown	Het
Oplah	G	T	15: 76,302,483	C665*	probably null	Het
Otogl	T	C	10: 107,783,712	T1696A	possibly damaging	Het
Pdzrn4	A	G	15: 92,401,974	I242V	probably benign	Het
Phgdh	G	A	3: 98,328,135	T141I	probably benign	Het
Pigv	T	C	4: 133,664,926	Y311C	probably damaging	Het
Pitpnm1	A	T	19: 4,109,960	K760*	probably null	Het
Pnrc1	G	A	4: 33,246,438	H174Y	probably damaging	Het
Ptgis	A	G	2: 167,191,968		probably benign	Het
Ptpn4	T	C	1: 119,716,043		probably null	Het
Rin3	T	A	12: 102,369,330	L420*	probably null	Het
Sacs	T	G	14: 61,205,454	F1650V	probably damaging	Het
Sbno2	T	A	10: 80,058,508	N1081Y	possibly damaging	Het
Sema5b	C	T	16: 35,646,367	P213L	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint6	T	A	4: 113,177,037		probably benign	Het
Slc4a2	A	G	5: 24,429,567	E68G	probably damaging	Het
Srcin1	C	T	11: 97,533,501	V634I	probably benign	Het
Srsf10	T	A	4: 135,863,165	F134I	possibly damaging	Het
Stab1	C	A	14: 31,145,303	G1700V	probably damaging	Het
Sun1	T	G	5: 139,230,789	C290W	possibly damaging	Het
Svs6	T	A	2: 164,317,657		probably benign	Het
Tmem8b	G	A	4: 43,690,228		probably null	Het
Usp49	A	G	17: 47,672,313	D81G	probably damaging	Het
Vmn1r215	T	A	13: 23,076,678	V296D	probably benign	Het
Vmn1r6	T	A	6: 57,002,622	S90T	probably damaging	Het
Wbp2	A	G	11: 116,083,883	F42L	probably benign	Het
Wdr20rt	C	T	12: 65,227,281	T333I	possibly damaging	Het
Zfp341	C	T	2: 154,641,378	A552V	probably benign	Het
Zfp607b	A	T	7: 27,692,524	H8L	possibly damaging	Het
Zfp758	G	T	17: 22,375,849	D439Y	probably damaging	Het
Zfp946	T	C	17: 22,453,557	Y46H	probably damaging	Het
Zic2	G	A	14: 122,478,947	E432K	probably damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGCTAGACAGCTCAAAGCC -3'
(R):5'- TGCGTCTTCTGAACCCAAGAGTG -3'

Sequencing Primer
(F):5'- TAGACAGCTCAAAGCCTCTTGG -3'
(R):5'- gttcttcctgcctcttcctc -3'

Posted On

2014-05-23