Incidental Mutation 'R1733:Pik3c2a'
ID199486
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1733 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to G at 116418520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170430
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205378
AA Change: M1L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205767
Predicted Effect possibly damaging
Transcript: ENSMUST00000206219
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.7574 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cp A T 3: 19,968,219 probably benign Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mapk8ip3 A T 17: 24,936,850 M2K possibly damaging Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mlkl A G 8: 111,322,748 S248P probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr1307 T A 2: 111,945,280 M59L probably benign Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Stab1 C A 14: 31,145,303 G1700V probably damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCTAGACAGCTCAAAGCC -3'
(R):5'- TGCGTCTTCTGAACCCAAGAGTG -3'

Sequencing Primer
(F):5'- TAGACAGCTCAAAGCCTCTTGG -3'
(R):5'- gttcttcctgcctcttcctc -3'
Posted On2014-05-23