Incidental Mutation 'R1733:Pik3c2a'
ID 199486
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms PI3KC2
MMRRC Submission 039765-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1733 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 115936500-116042684 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to G at 116017755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000170430
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205378
AA Change: M1L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205767
Predicted Effect possibly damaging
Transcript: ENSMUST00000206219
AA Change: M1L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.7574 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,165,001 (GRCm39) C1034W probably damaging Het
Agbl2 G T 2: 90,641,089 (GRCm39) K737N probably damaging Het
Aqp9 T A 9: 71,019,624 (GRCm39) I279F possibly damaging Het
Aspm T A 1: 139,384,855 (GRCm39) N166K probably benign Het
Atp13a3 A T 16: 30,176,084 (GRCm39) I186N probably benign Het
Btaf1 A T 19: 36,972,362 (GRCm39) I1366L probably benign Het
Camk4 A C 18: 33,211,074 (GRCm39) K60Q possibly damaging Het
Card11 G T 5: 140,892,388 (GRCm39) Q226K possibly damaging Het
Ccdc187 T C 2: 26,183,670 (GRCm39) D110G possibly damaging Het
Col5a2 C T 1: 45,446,192 (GRCm39) R462Q possibly damaging Het
Cp A T 3: 20,022,383 (GRCm39) probably benign Het
Cpz A T 5: 35,675,102 (GRCm39) V38E probably damaging Het
Cxcr6 G A 9: 123,639,181 (GRCm39) V68I probably damaging Het
Cyp2a22 C A 7: 26,634,187 (GRCm39) E322D possibly damaging Het
D130052B06Rik C T 11: 33,573,784 (GRCm39) T127I probably benign Het
Daam2 T A 17: 49,797,231 (GRCm39) M185L possibly damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Dnttip2 T A 3: 122,070,397 (GRCm39) S537R probably benign Het
Dock9 G T 14: 121,864,292 (GRCm39) H572Q probably benign Het
Dpp4 T A 2: 62,203,213 (GRCm39) probably null Het
Enc1 T G 13: 97,381,550 (GRCm39) I20S possibly damaging Het
Ephb6 T A 6: 41,596,654 (GRCm39) H900Q probably benign Het
Ercc3 T C 18: 32,400,218 (GRCm39) V690A possibly damaging Het
Fam90a1a C T 8: 22,453,385 (GRCm39) Q247* probably null Het
Fkbp10 G A 11: 100,314,757 (GRCm39) R423H probably benign Het
Fus A G 7: 127,580,717 (GRCm39) M265V probably benign Het
Gas2l3 T A 10: 89,250,127 (GRCm39) K330N probably damaging Het
Gpam T G 19: 55,069,901 (GRCm39) L410F probably damaging Het
Gpr37l1 A T 1: 135,089,273 (GRCm39) V264E possibly damaging Het
Grk6 A T 13: 55,600,979 (GRCm39) probably benign Het
Gsto1 G T 19: 47,843,674 (GRCm39) V19F probably damaging Het
H1f7 G T 15: 98,154,016 (GRCm39) Q378K unknown Het
Hgfac G A 5: 35,201,018 (GRCm39) C194Y probably damaging Het
Hivep1 A G 13: 42,311,407 (GRCm39) N1216D probably damaging Het
Hrg C T 16: 22,769,997 (GRCm39) A42V probably damaging Het
Irx4 A G 13: 73,414,824 (GRCm39) D136G probably benign Het
Kcnn3 G T 3: 89,559,397 (GRCm39) V556L probably benign Het
Klk1b8 T C 7: 43,451,545 (GRCm39) Y179H possibly damaging Het
Klrb1f T A 6: 129,031,322 (GRCm39) L173* probably null Het
Kremen2 A T 17: 23,962,373 (GRCm39) probably null Het
Krt25 A T 11: 99,207,378 (GRCm39) Y400* probably null Het
Lingo4 A T 3: 94,310,485 (GRCm39) R474S probably benign Het
Lnpep T C 17: 17,773,575 (GRCm39) K599E probably benign Het
Mapk8ip3 A T 17: 25,155,824 (GRCm39) M2K possibly damaging Het
Mat2b A T 11: 40,570,904 (GRCm39) S307T probably benign Het
Mcph1 C A 8: 18,681,979 (GRCm39) A372D probably benign Het
Mfsd6 T A 1: 52,748,524 (GRCm39) I114F probably damaging Het
Mlkl A G 8: 112,049,380 (GRCm39) S248P probably damaging Het
Mmrn1 A T 6: 60,954,085 (GRCm39) T789S probably benign Het
Mphosph8 A G 14: 56,930,916 (GRCm39) Y735C probably damaging Het
Mrc1 T A 2: 14,261,910 (GRCm39) Y300N probably damaging Het
Mrps11 A G 7: 78,442,460 (GRCm39) H180R probably damaging Het
Msh4 T C 3: 153,573,404 (GRCm39) D556G probably damaging Het
Myh10 C A 11: 68,693,122 (GRCm39) D1472E probably benign Het
Myo16 T C 8: 10,492,283 (GRCm39) S742P probably damaging Het
Nlrp5-ps C T 7: 14,316,978 (GRCm39) noncoding transcript Het
Nrp1 C T 8: 129,194,974 (GRCm39) P477S probably benign Het
Oplah G T 15: 76,186,683 (GRCm39) C665* probably null Het
Or4f14b T A 2: 111,775,625 (GRCm39) M59L probably benign Het
Or4f54 T C 2: 111,123,210 (GRCm39) V199A probably damaging Het
Or51b17 T C 7: 103,542,118 (GRCm39) S275G probably benign Het
Or8g22 G T 9: 38,958,678 (GRCm39) H57N unknown Het
Otogl T C 10: 107,619,573 (GRCm39) T1696A possibly damaging Het
Pdzrn4 A G 15: 92,299,855 (GRCm39) I242V probably benign Het
Phgdh G A 3: 98,235,451 (GRCm39) T141I probably benign Het
Pigv T C 4: 133,392,237 (GRCm39) Y311C probably damaging Het
Pitpnm1 A T 19: 4,159,960 (GRCm39) K760* probably null Het
Pnrc1 G A 4: 33,246,438 (GRCm39) H174Y probably damaging Het
Ptgis A G 2: 167,033,888 (GRCm39) probably benign Het
Ptpn4 T C 1: 119,643,773 (GRCm39) probably null Het
Rin3 T A 12: 102,335,589 (GRCm39) L420* probably null Het
Sacs T G 14: 61,442,903 (GRCm39) F1650V probably damaging Het
Sbno2 T A 10: 79,894,342 (GRCm39) N1081Y possibly damaging Het
Sema5b C T 16: 35,466,737 (GRCm39) P213L probably damaging Het
Sharpin T C 15: 76,232,136 (GRCm39) K240R probably benign Het
Skint6 T A 4: 113,034,234 (GRCm39) probably benign Het
Slc4a2 A G 5: 24,634,565 (GRCm39) E68G probably damaging Het
Srcin1 C T 11: 97,424,327 (GRCm39) V634I probably benign Het
Srsf10 T A 4: 135,590,476 (GRCm39) F134I possibly damaging Het
Stab1 C A 14: 30,867,260 (GRCm39) G1700V probably damaging Het
Sun1 T G 5: 139,216,544 (GRCm39) C290W possibly damaging Het
Svs6 T A 2: 164,159,577 (GRCm39) probably benign Het
Tmem8b G A 4: 43,690,228 (GRCm39) probably null Het
Usp49 A G 17: 47,983,238 (GRCm39) D81G probably damaging Het
Vmn1r215 T A 13: 23,260,848 (GRCm39) V296D probably benign Het
Vmn1r6 T A 6: 56,979,607 (GRCm39) S90T probably damaging Het
Wbp2 A G 11: 115,974,709 (GRCm39) F42L probably benign Het
Wdr20rt C T 12: 65,274,055 (GRCm39) T333I possibly damaging Het
Zfp341 C T 2: 154,483,298 (GRCm39) A552V probably benign Het
Zfp607b A T 7: 27,391,949 (GRCm39) H8L possibly damaging Het
Zfp758 G T 17: 22,594,830 (GRCm39) D439Y probably damaging Het
Zfp946 T C 17: 22,672,538 (GRCm39) Y46H probably damaging Het
Zic2 G A 14: 122,716,359 (GRCm39) E432K probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 115,975,518 (GRCm39) missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 115,963,735 (GRCm39) missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 115,973,038 (GRCm39) missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116,017,429 (GRCm39) missense probably benign 0.01
IGL01462:Pik3c2a APN 7 115,975,485 (GRCm39) missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 115,950,000 (GRCm39) intron probably benign
IGL01695:Pik3c2a APN 7 116,016,753 (GRCm39) missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 115,945,423 (GRCm39) missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 115,950,039 (GRCm39) missense probably benign 0.00
IGL02160:Pik3c2a APN 7 115,987,299 (GRCm39) missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 115,962,575 (GRCm39) splice site probably benign
IGL02345:Pik3c2a APN 7 116,005,126 (GRCm39) missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 115,972,049 (GRCm39) missense probably benign 0.00
IGL02756:Pik3c2a APN 7 115,963,748 (GRCm39) missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116,017,256 (GRCm39) missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116,017,074 (GRCm39) missense probably benign 0.21
R0046:Pik3c2a UTSW 7 115,953,307 (GRCm39) missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 115,972,979 (GRCm39) missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 115,953,290 (GRCm39) missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 115,945,482 (GRCm39) splice site probably benign
R0991:Pik3c2a UTSW 7 115,961,280 (GRCm39) critical splice donor site probably null
R1074:Pik3c2a UTSW 7 115,950,160 (GRCm39) nonsense probably null
R1485:Pik3c2a UTSW 7 116,016,908 (GRCm39) missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 115,987,300 (GRCm39) missense probably benign 0.01
R1510:Pik3c2a UTSW 7 115,987,280 (GRCm39) missense probably benign 0.00
R1654:Pik3c2a UTSW 7 115,968,083 (GRCm39) missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116,017,162 (GRCm39) nonsense probably null
R1751:Pik3c2a UTSW 7 115,945,471 (GRCm39) missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116,016,899 (GRCm39) missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 115,975,747 (GRCm39) critical splice donor site probably null
R1826:Pik3c2a UTSW 7 115,967,352 (GRCm39) missense probably benign
R1875:Pik3c2a UTSW 7 116,017,206 (GRCm39) missense probably benign 0.35
R1995:Pik3c2a UTSW 7 115,953,241 (GRCm39) missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 115,941,472 (GRCm39) missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 115,963,738 (GRCm39) missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 115,950,057 (GRCm39) missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116,016,686 (GRCm39) critical splice donor site probably null
R2068:Pik3c2a UTSW 7 115,972,126 (GRCm39) nonsense probably null
R3814:Pik3c2a UTSW 7 115,947,414 (GRCm39) missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 115,963,785 (GRCm39) nonsense probably null
R4386:Pik3c2a UTSW 7 115,953,334 (GRCm39) missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 115,957,923 (GRCm39) missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116,017,060 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 115,975,518 (GRCm39) missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 115,947,509 (GRCm39) missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 115,941,636 (GRCm39) missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 115,950,021 (GRCm39) missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116,016,893 (GRCm39) missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116,005,186 (GRCm39) missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R5951:Pik3c2a UTSW 7 115,967,419 (GRCm39) missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 115,961,799 (GRCm39) missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 115,947,440 (GRCm39) missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116,016,731 (GRCm39) missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 115,939,460 (GRCm39) critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 115,967,993 (GRCm39) missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 115,961,419 (GRCm39) missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 115,993,540 (GRCm39) missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116,017,223 (GRCm39) missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116,017,368 (GRCm39) nonsense probably null
R7153:Pik3c2a UTSW 7 115,941,487 (GRCm39) missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 115,987,331 (GRCm39) missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 115,987,321 (GRCm39) missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116,005,178 (GRCm39) missense probably benign 0.00
R7308:Pik3c2a UTSW 7 115,973,074 (GRCm39) missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 115,975,621 (GRCm39) missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 115,953,242 (GRCm39) missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 115,972,089 (GRCm39) missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 115,993,474 (GRCm39) missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 115,939,331 (GRCm39) missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 115,987,312 (GRCm39) nonsense probably null
R7737:Pik3c2a UTSW 7 115,955,488 (GRCm39) missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 115,993,529 (GRCm39) missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116,016,693 (GRCm39) missense probably benign
R7922:Pik3c2a UTSW 7 115,990,517 (GRCm39) missense probably damaging 1.00
R7956:Pik3c2a UTSW 7 115,949,350 (GRCm39) missense probably benign 0.01
R8005:Pik3c2a UTSW 7 116,017,271 (GRCm39) missense probably damaging 1.00
R8158:Pik3c2a UTSW 7 115,942,232 (GRCm39) missense probably benign 0.00
R8329:Pik3c2a UTSW 7 116,017,283 (GRCm39) missense probably damaging 1.00
R8478:Pik3c2a UTSW 7 116,017,584 (GRCm39) missense probably damaging 0.96
R8736:Pik3c2a UTSW 7 115,975,464 (GRCm39) missense possibly damaging 0.47
R8812:Pik3c2a UTSW 7 115,951,112 (GRCm39) missense probably damaging 1.00
R8922:Pik3c2a UTSW 7 116,017,659 (GRCm39) missense probably damaging 1.00
R8953:Pik3c2a UTSW 7 115,987,320 (GRCm39) missense probably benign 0.19
R9105:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R9111:Pik3c2a UTSW 7 115,993,531 (GRCm39) missense probably damaging 0.99
R9152:Pik3c2a UTSW 7 116,017,004 (GRCm39) missense probably benign 0.30
R9241:Pik3c2a UTSW 7 116,017,115 (GRCm39) missense probably benign 0.02
R9301:Pik3c2a UTSW 7 115,945,413 (GRCm39) missense probably damaging 1.00
R9325:Pik3c2a UTSW 7 115,990,558 (GRCm39) missense probably damaging 0.99
R9482:Pik3c2a UTSW 7 115,961,289 (GRCm39) missense probably benign 0.04
R9513:Pik3c2a UTSW 7 115,939,321 (GRCm39) missense probably benign 0.06
R9569:Pik3c2a UTSW 7 115,957,939 (GRCm39) missense possibly damaging 0.89
R9758:Pik3c2a UTSW 7 115,945,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTAGACAGCTCAAAGCC -3'
(R):5'- TGCGTCTTCTGAACCCAAGAGTG -3'

Sequencing Primer
(F):5'- TAGACAGCTCAAAGCCTCTTGG -3'
(R):5'- gttcttcctgcctcttcctc -3'
Posted On 2014-05-23