Incidental Mutation 'R1733:Mlkl'
ID199491
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Namemixed lineage kinase domain-like
Synonyms9130019I15Rik
MMRRC Submission 039765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1733 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111311797-111338177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111322748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 248 (S248P)
Ref Sequence ENSEMBL: ENSMUSP00000113718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432]
Predicted Effect probably damaging
Transcript: ENSMUST00000056157
AA Change: S248P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: S248P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212417
Meta Mutation Damage Score 0.8982 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,031,929 C1034W probably damaging Het
Agbl2 G T 2: 90,810,745 K737N probably damaging Het
Aqp9 T A 9: 71,112,342 I279F possibly damaging Het
Aspm T A 1: 139,457,117 N166K probably benign Het
Atp13a3 A T 16: 30,357,266 I186N probably benign Het
Btaf1 A T 19: 36,994,962 I1366L probably benign Het
Camk4 A C 18: 33,078,021 K60Q possibly damaging Het
Card11 G T 5: 140,906,633 Q226K possibly damaging Het
Ccdc187 T C 2: 26,293,658 D110G possibly damaging Het
Col5a2 C T 1: 45,407,032 R462Q possibly damaging Het
Cp A T 3: 19,968,219 probably benign Het
Cpz A T 5: 35,517,758 V38E probably damaging Het
Cxcr6 G A 9: 123,810,116 V68I probably damaging Het
Cyp2a22 C A 7: 26,934,762 E322D possibly damaging Het
D130052B06Rik C T 11: 33,623,784 T127I probably benign Het
Daam2 T A 17: 49,490,203 M185L possibly damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Dnttip2 T A 3: 122,276,748 S537R probably benign Het
Dock9 G T 14: 121,626,880 H572Q probably benign Het
Dpp4 T A 2: 62,372,869 probably null Het
Enc1 T G 13: 97,245,042 I20S possibly damaging Het
Ephb6 T A 6: 41,619,720 H900Q probably benign Het
Ercc3 T C 18: 32,267,165 V690A possibly damaging Het
Fam90a1a C T 8: 21,963,369 Q247* probably null Het
Fkbp10 G A 11: 100,423,931 R423H probably benign Het
Fus A G 7: 127,981,545 M265V probably benign Het
Gas2l3 T A 10: 89,414,265 K330N probably damaging Het
Gpam T G 19: 55,081,469 L410F probably damaging Het
Gpr37l1 A T 1: 135,161,535 V264E possibly damaging Het
Grk6 A T 13: 55,453,166 probably benign Het
Gsto1 G T 19: 47,855,235 V19F probably damaging Het
H1fnt G T 15: 98,256,135 Q378K unknown Het
Hgfac G A 5: 35,043,674 C194Y probably damaging Het
Hivep1 A G 13: 42,157,931 N1216D probably damaging Het
Hrg C T 16: 22,951,247 A42V probably damaging Het
Irx4 A G 13: 73,266,705 D136G probably benign Het
Kcnn3 G T 3: 89,652,090 V556L probably benign Het
Klk8 T C 7: 43,802,121 Y179H possibly damaging Het
Klrb1f T A 6: 129,054,359 L173* probably null Het
Kremen2 A T 17: 23,743,399 probably null Het
Krt25 A T 11: 99,316,552 Y400* probably null Het
Lingo4 A T 3: 94,403,178 R474S probably benign Het
Lnpep T C 17: 17,553,313 K599E probably benign Het
Mapk8ip3 A T 17: 24,936,850 M2K possibly damaging Het
Mat2b A T 11: 40,680,077 S307T probably benign Het
Mcph1 C A 8: 18,631,963 A372D probably benign Het
Mfsd6 T A 1: 52,709,365 I114F probably damaging Het
Mmrn1 A T 6: 60,977,101 T789S probably benign Het
Mphosph8 A G 14: 56,693,459 Y735C probably damaging Het
Mrc1 T A 2: 14,257,099 Y300N probably damaging Het
Mrps11 A G 7: 78,792,712 H180R probably damaging Het
Msh4 T C 3: 153,867,767 D556G probably damaging Het
Myh10 C A 11: 68,802,296 D1472E probably benign Het
Myo16 T C 8: 10,442,283 S742P probably damaging Het
Nlrp5-ps C T 7: 14,583,053 noncoding transcript Het
Nrp1 C T 8: 128,468,493 P477S probably benign Het
Olfr1278 T C 2: 111,292,865 V199A probably damaging Het
Olfr1307 T A 2: 111,945,280 M59L probably benign Het
Olfr64 T C 7: 103,892,911 S275G probably benign Het
Olfr936 G T 9: 39,047,382 H57N unknown Het
Oplah G T 15: 76,302,483 C665* probably null Het
Otogl T C 10: 107,783,712 T1696A possibly damaging Het
Pdzrn4 A G 15: 92,401,974 I242V probably benign Het
Phgdh G A 3: 98,328,135 T141I probably benign Het
Pigv T C 4: 133,664,926 Y311C probably damaging Het
Pik3c2a T G 7: 116,418,520 M1L possibly damaging Het
Pitpnm1 A T 19: 4,109,960 K760* probably null Het
Pnrc1 G A 4: 33,246,438 H174Y probably damaging Het
Ptgis A G 2: 167,191,968 probably benign Het
Ptpn4 T C 1: 119,716,043 probably null Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Sacs T G 14: 61,205,454 F1650V probably damaging Het
Sbno2 T A 10: 80,058,508 N1081Y possibly damaging Het
Sema5b C T 16: 35,646,367 P213L probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint6 T A 4: 113,177,037 probably benign Het
Slc4a2 A G 5: 24,429,567 E68G probably damaging Het
Srcin1 C T 11: 97,533,501 V634I probably benign Het
Srsf10 T A 4: 135,863,165 F134I possibly damaging Het
Stab1 C A 14: 31,145,303 G1700V probably damaging Het
Sun1 T G 5: 139,230,789 C290W possibly damaging Het
Svs6 T A 2: 164,317,657 probably benign Het
Tmem8b G A 4: 43,690,228 probably null Het
Usp49 A G 17: 47,672,313 D81G probably damaging Het
Vmn1r215 T A 13: 23,076,678 V296D probably benign Het
Vmn1r6 T A 6: 57,002,622 S90T probably damaging Het
Wbp2 A G 11: 116,083,883 F42L probably benign Het
Wdr20rt C T 12: 65,227,281 T333I possibly damaging Het
Zfp341 C T 2: 154,641,378 A552V probably benign Het
Zfp607b A T 7: 27,692,524 H8L possibly damaging Het
Zfp758 G T 17: 22,375,849 D439Y probably damaging Het
Zfp946 T C 17: 22,453,557 Y46H probably damaging Het
Zic2 G A 14: 122,478,947 E432K probably damaging Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCTGACCTCCATGCTTAAATC -3'
(R):5'- CTGCCTCCAAGTTCATCTGGGAAG -3'

Sequencing Primer
(F):5'- TGACCTCCATGCTTAAATCGAAAAG -3'
(R):5'- GTTAGATTTACAGCCAAGCCTGTC -3'
Posted On2014-05-23