Incidental Mutation 'R0087:Olfr616'
ID19950
Institutional Source Beutler Lab
Gene Symbol Olfr616
Ensembl Gene ENSMUSG00000047544
Gene Nameolfactory receptor 616
SynonymsMOR19-1, GA_x6K02T2PBJ9-6289676-6288723
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0087 (G1)
Quality Score190
Status Validated (trace)
Chromosome7
Chromosomal Location103563747-103569143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103564362 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 306 (C306S)
Ref Sequence ENSEMBL: ENSMUSP00000150954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
AA Change: C306S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544
AA Change: C306S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably benign
Transcript: ENSMUST00000214806
AA Change: C306S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Predicted Effect probably benign
Transcript: ENSMUST00000217293
AA Change: C306S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Olfr616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Olfr616 APN 7 103565021 missense probably damaging 0.99
IGL02366:Olfr616 APN 7 103564415 missense probably damaging 1.00
IGL03028:Olfr616 APN 7 103564589 unclassified probably null
R1450:Olfr616 UTSW 7 103564451 missense probably benign 0.12
R1900:Olfr616 UTSW 7 103564607 nonsense probably null
R2026:Olfr616 UTSW 7 103564877 missense probably damaging 1.00
R2139:Olfr616 UTSW 7 103564754 missense possibly damaging 0.90
R2883:Olfr616 UTSW 7 103565264 missense probably benign 0.24
R4359:Olfr616 UTSW 7 103564535 missense probably benign 0.29
R4589:Olfr616 UTSW 7 103564432 missense probably damaging 0.98
R4827:Olfr616 UTSW 7 103564545 missense probably damaging 1.00
R5023:Olfr616 UTSW 7 103565171 missense possibly damaging 0.95
R5397:Olfr616 UTSW 7 103564506 missense probably damaging 0.99
R6109:Olfr616 UTSW 7 103565139 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGTAGCATCTGCTAGGTTTCCACATC -3'
(R):5'- CTCAAGGCACTCAATACCTGTGTCTC -3'

Sequencing Primer
(F):5'- ACATCCCTTCAAGTTTTGCATAGG -3'
(R):5'- AATACCTGTGTCTCCCACATATTTAC -3'
Posted On2013-04-11