Incidental Mutation 'R1733:Fkbp10'
ID 199505
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene Name FK506 binding protein 10
Synonyms Fkbp-rs1, Fkbp1-rs, FKBP65, Fkbp6, 65kDa
MMRRC Submission 039765-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1733 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 100306523-100315650 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100314757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 423 (R423H)
Ref Sequence ENSEMBL: ENSMUSP00000103023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000107398] [ENSMUST00000107399] [ENSMUST00000107400]
AlphaFold Q61576
Predicted Effect probably benign
Transcript: ENSMUST00000001595
AA Change: R535H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: R535H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107398
SMART Domains Protein: ENSMUSP00000103021
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107399
SMART Domains Protein: ENSMUSP00000103022
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107400
AA Change: R423H

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: R423H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125616
Predicted Effect probably benign
Transcript: ENSMUST00000134815
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 T G 18: 59,165,001 (GRCm39) C1034W probably damaging Het
Agbl2 G T 2: 90,641,089 (GRCm39) K737N probably damaging Het
Aqp9 T A 9: 71,019,624 (GRCm39) I279F possibly damaging Het
Aspm T A 1: 139,384,855 (GRCm39) N166K probably benign Het
Atp13a3 A T 16: 30,176,084 (GRCm39) I186N probably benign Het
Btaf1 A T 19: 36,972,362 (GRCm39) I1366L probably benign Het
Camk4 A C 18: 33,211,074 (GRCm39) K60Q possibly damaging Het
Card11 G T 5: 140,892,388 (GRCm39) Q226K possibly damaging Het
Ccdc187 T C 2: 26,183,670 (GRCm39) D110G possibly damaging Het
Col5a2 C T 1: 45,446,192 (GRCm39) R462Q possibly damaging Het
Cp A T 3: 20,022,383 (GRCm39) probably benign Het
Cpz A T 5: 35,675,102 (GRCm39) V38E probably damaging Het
Cxcr6 G A 9: 123,639,181 (GRCm39) V68I probably damaging Het
Cyp2a22 C A 7: 26,634,187 (GRCm39) E322D possibly damaging Het
D130052B06Rik C T 11: 33,573,784 (GRCm39) T127I probably benign Het
Daam2 T A 17: 49,797,231 (GRCm39) M185L possibly damaging Het
Dnaja3 G A 16: 4,502,029 (GRCm39) R11K probably null Het
Dnttip2 T A 3: 122,070,397 (GRCm39) S537R probably benign Het
Dock9 G T 14: 121,864,292 (GRCm39) H572Q probably benign Het
Dpp4 T A 2: 62,203,213 (GRCm39) probably null Het
Enc1 T G 13: 97,381,550 (GRCm39) I20S possibly damaging Het
Ephb6 T A 6: 41,596,654 (GRCm39) H900Q probably benign Het
Ercc3 T C 18: 32,400,218 (GRCm39) V690A possibly damaging Het
Fam90a1a C T 8: 22,453,385 (GRCm39) Q247* probably null Het
Fus A G 7: 127,580,717 (GRCm39) M265V probably benign Het
Gas2l3 T A 10: 89,250,127 (GRCm39) K330N probably damaging Het
Gpam T G 19: 55,069,901 (GRCm39) L410F probably damaging Het
Gpr37l1 A T 1: 135,089,273 (GRCm39) V264E possibly damaging Het
Grk6 A T 13: 55,600,979 (GRCm39) probably benign Het
Gsto1 G T 19: 47,843,674 (GRCm39) V19F probably damaging Het
H1f7 G T 15: 98,154,016 (GRCm39) Q378K unknown Het
Hgfac G A 5: 35,201,018 (GRCm39) C194Y probably damaging Het
Hivep1 A G 13: 42,311,407 (GRCm39) N1216D probably damaging Het
Hrg C T 16: 22,769,997 (GRCm39) A42V probably damaging Het
Irx4 A G 13: 73,414,824 (GRCm39) D136G probably benign Het
Kcnn3 G T 3: 89,559,397 (GRCm39) V556L probably benign Het
Klk1b8 T C 7: 43,451,545 (GRCm39) Y179H possibly damaging Het
Klrb1f T A 6: 129,031,322 (GRCm39) L173* probably null Het
Kremen2 A T 17: 23,962,373 (GRCm39) probably null Het
Krt25 A T 11: 99,207,378 (GRCm39) Y400* probably null Het
Lingo4 A T 3: 94,310,485 (GRCm39) R474S probably benign Het
Lnpep T C 17: 17,773,575 (GRCm39) K599E probably benign Het
Mapk8ip3 A T 17: 25,155,824 (GRCm39) M2K possibly damaging Het
Mat2b A T 11: 40,570,904 (GRCm39) S307T probably benign Het
Mcph1 C A 8: 18,681,979 (GRCm39) A372D probably benign Het
Mfsd6 T A 1: 52,748,524 (GRCm39) I114F probably damaging Het
Mlkl A G 8: 112,049,380 (GRCm39) S248P probably damaging Het
Mmrn1 A T 6: 60,954,085 (GRCm39) T789S probably benign Het
Mphosph8 A G 14: 56,930,916 (GRCm39) Y735C probably damaging Het
Mrc1 T A 2: 14,261,910 (GRCm39) Y300N probably damaging Het
Mrps11 A G 7: 78,442,460 (GRCm39) H180R probably damaging Het
Msh4 T C 3: 153,573,404 (GRCm39) D556G probably damaging Het
Myh10 C A 11: 68,693,122 (GRCm39) D1472E probably benign Het
Myo16 T C 8: 10,492,283 (GRCm39) S742P probably damaging Het
Nlrp5-ps C T 7: 14,316,978 (GRCm39) noncoding transcript Het
Nrp1 C T 8: 129,194,974 (GRCm39) P477S probably benign Het
Oplah G T 15: 76,186,683 (GRCm39) C665* probably null Het
Or4f14b T A 2: 111,775,625 (GRCm39) M59L probably benign Het
Or4f54 T C 2: 111,123,210 (GRCm39) V199A probably damaging Het
Or51b17 T C 7: 103,542,118 (GRCm39) S275G probably benign Het
Or8g22 G T 9: 38,958,678 (GRCm39) H57N unknown Het
Otogl T C 10: 107,619,573 (GRCm39) T1696A possibly damaging Het
Pdzrn4 A G 15: 92,299,855 (GRCm39) I242V probably benign Het
Phgdh G A 3: 98,235,451 (GRCm39) T141I probably benign Het
Pigv T C 4: 133,392,237 (GRCm39) Y311C probably damaging Het
Pik3c2a T G 7: 116,017,755 (GRCm39) M1L possibly damaging Het
Pitpnm1 A T 19: 4,159,960 (GRCm39) K760* probably null Het
Pnrc1 G A 4: 33,246,438 (GRCm39) H174Y probably damaging Het
Ptgis A G 2: 167,033,888 (GRCm39) probably benign Het
Ptpn4 T C 1: 119,643,773 (GRCm39) probably null Het
Rin3 T A 12: 102,335,589 (GRCm39) L420* probably null Het
Sacs T G 14: 61,442,903 (GRCm39) F1650V probably damaging Het
Sbno2 T A 10: 79,894,342 (GRCm39) N1081Y possibly damaging Het
Sema5b C T 16: 35,466,737 (GRCm39) P213L probably damaging Het
Sharpin T C 15: 76,232,136 (GRCm39) K240R probably benign Het
Skint6 T A 4: 113,034,234 (GRCm39) probably benign Het
Slc4a2 A G 5: 24,634,565 (GRCm39) E68G probably damaging Het
Srcin1 C T 11: 97,424,327 (GRCm39) V634I probably benign Het
Srsf10 T A 4: 135,590,476 (GRCm39) F134I possibly damaging Het
Stab1 C A 14: 30,867,260 (GRCm39) G1700V probably damaging Het
Sun1 T G 5: 139,216,544 (GRCm39) C290W possibly damaging Het
Svs6 T A 2: 164,159,577 (GRCm39) probably benign Het
Tmem8b G A 4: 43,690,228 (GRCm39) probably null Het
Usp49 A G 17: 47,983,238 (GRCm39) D81G probably damaging Het
Vmn1r215 T A 13: 23,260,848 (GRCm39) V296D probably benign Het
Vmn1r6 T A 6: 56,979,607 (GRCm39) S90T probably damaging Het
Wbp2 A G 11: 115,974,709 (GRCm39) F42L probably benign Het
Wdr20rt C T 12: 65,274,055 (GRCm39) T333I possibly damaging Het
Zfp341 C T 2: 154,483,298 (GRCm39) A552V probably benign Het
Zfp607b A T 7: 27,391,949 (GRCm39) H8L possibly damaging Het
Zfp758 G T 17: 22,594,830 (GRCm39) D439Y probably damaging Het
Zfp946 T C 17: 22,672,538 (GRCm39) Y46H probably damaging Het
Zic2 G A 14: 122,716,359 (GRCm39) E432K probably damaging Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100,312,643 (GRCm39) missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100,306,843 (GRCm39) missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100,306,782 (GRCm39) missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100,306,803 (GRCm39) missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100,313,481 (GRCm39) missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100,313,580 (GRCm39) missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100,306,740 (GRCm39) missense probably damaging 1.00
R1817:Fkbp10 UTSW 11 100,306,715 (GRCm39) missense probably benign 0.13
R1819:Fkbp10 UTSW 11 100,306,715 (GRCm39) missense probably benign 0.13
R1831:Fkbp10 UTSW 11 100,314,045 (GRCm39) missense probably damaging 1.00
R1997:Fkbp10 UTSW 11 100,306,841 (GRCm39) missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100,312,499 (GRCm39) missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100,313,451 (GRCm39) critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100,313,925 (GRCm39) missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100,311,849 (GRCm39) missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100,314,352 (GRCm39) missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100,314,352 (GRCm39) missense probably damaging 1.00
R5698:Fkbp10 UTSW 11 100,314,352 (GRCm39) missense probably damaging 1.00
R5706:Fkbp10 UTSW 11 100,311,849 (GRCm39) missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100,312,129 (GRCm39) missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100,306,707 (GRCm39) missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100,312,048 (GRCm39) missense probably damaging 1.00
R8237:Fkbp10 UTSW 11 100,306,785 (GRCm39) missense probably damaging 1.00
R8886:Fkbp10 UTSW 11 100,312,862 (GRCm39) missense probably damaging 1.00
R8978:Fkbp10 UTSW 11 100,313,936 (GRCm39) missense probably benign 0.19
R9484:Fkbp10 UTSW 11 100,313,960 (GRCm39) missense probably damaging 1.00
R9505:Fkbp10 UTSW 11 100,306,826 (GRCm39) nonsense probably null
R9590:Fkbp10 UTSW 11 100,306,785 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCAGGAACTCAGTCACAACC -3'
(R):5'- TGGGAAGACCACAGTAGTCTCCAC -3'

Sequencing Primer
(F):5'- ATGCTCACTGCCCTCTGG -3'
(R):5'- TGATATCCAGTGACTCCCAGAG -3'
Posted On 2014-05-23