Incidental Mutation 'R1734:Retreg2'
ID199542
Institutional Source Beutler Lab
Gene Symbol Retreg2
Ensembl Gene ENSMUSG00000049339
Gene Namereticulophagy regulator family member 2
SynonymsMGC47289, Fam134a
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1734 (G1)
Quality Score169
Status Validated
Chromosome1
Chromosomal Location75142778-75147913 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 75142986 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041213] [ENSMUST00000097694] [ENSMUST00000168720] [ENSMUST00000187901] [ENSMUST00000188873] [ENSMUST00000189403] [ENSMUST00000189650] [ENSMUST00000190240] [ENSMUST00000190679] [ENSMUST00000189809]
Predicted Effect probably null
Transcript: ENSMUST00000041213
SMART Domains Protein: ENSMUSP00000044799
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 72 174 7.5e-10 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097694
AA Change: E42*
SMART Domains Protein: ENSMUSP00000095300
Gene: ENSMUSG00000049339
AA Change: E42*

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 453 491 N/A INTRINSIC
low complexity region 506 520 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168720
SMART Domains Protein: ENSMUSP00000132688
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186037
Predicted Effect probably benign
Transcript: ENSMUST00000187901
SMART Domains Protein: ENSMUSP00000140636
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 12 39 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188873
AA Change: E42*
SMART Domains Protein: ENSMUSP00000139508
Gene: ENSMUSG00000049339
AA Change: E42*

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189043
Predicted Effect probably benign
Transcript: ENSMUST00000189345
Predicted Effect probably null
Transcript: ENSMUST00000189403
SMART Domains Protein: ENSMUSP00000141062
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 44 170 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189650
AA Change: E3*
SMART Domains Protein: ENSMUSP00000139473
Gene: ENSMUSG00000049339
AA Change: E3*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 75 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190240
AA Change: E42*
SMART Domains Protein: ENSMUSP00000139410
Gene: ENSMUSG00000049339
AA Change: E42*

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:Reticulon 65 231 1.4e-8 PFAM
low complexity region 269 283 N/A INTRINSIC
low complexity region 435 454 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190679
SMART Domains Protein: ENSMUSP00000140289
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189809
SMART Domains Protein: ENSMUSP00000140262
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Blast:CYCLIN 81 114 1e-10 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Retreg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Retreg2 APN 1 75145105 critical splice donor site probably null
IGL01625:Retreg2 APN 1 75144715 unclassified probably benign
R0143:Retreg2 UTSW 1 75146430 missense possibly damaging 0.82
R1248:Retreg2 UTSW 1 75145111 unclassified probably benign
R1446:Retreg2 UTSW 1 75143459 missense possibly damaging 0.69
R1463:Retreg2 UTSW 1 75146520 missense probably damaging 0.98
R1851:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R1852:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R2883:Retreg2 UTSW 1 75146712 missense probably benign 0.01
R3027:Retreg2 UTSW 1 75146444 missense probably damaging 0.99
R4665:Retreg2 UTSW 1 75144666 missense probably damaging 1.00
R5497:Retreg2 UTSW 1 75144989 missense probably damaging 1.00
R5544:Retreg2 UTSW 1 75144689 makesense probably null
R6143:Retreg2 UTSW 1 75146886 missense probably damaging 1.00
R6881:Retreg2 UTSW 1 75146439 missense probably damaging 1.00
R7576:Retreg2 UTSW 1 75144688 missense probably damaging 0.99
R7822:Retreg2 UTSW 1 75146541 missense possibly damaging 0.63
Z1176:Retreg2 UTSW 1 75145743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCCGATCCCAAGCAGATTGTAG -3'
(R):5'- TTACCAGAAGAGGCCGTTGAGTGTG -3'

Sequencing Primer
(F):5'- TGGAAGCACACCTTCGTG -3'
(R):5'- GCTTCTCCCAAACCAGCAG -3'
Posted On2014-05-23