Incidental Mutation 'R1734:Sned1'
ID 199544
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Name sushi, nidogen and EGF-like domains 1
Synonyms 6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1734 (G1)
Quality Score 159
Status Validated
Chromosome 1
Chromosomal Location 93235841-93301065 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 93259768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 256 (D256N)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062202
AA Change: D256N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: D256N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Meta Mutation Damage Score 0.3873 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
R7899:Sned1 UTSW 1 93274082 missense probably benign 0.04
R8093:Sned1 UTSW 1 93274665 missense possibly damaging 0.82
R8124:Sned1 UTSW 1 93282989 critical splice donor site probably null
R8489:Sned1 UTSW 1 93283256 nonsense probably null
R9012:Sned1 UTSW 1 93284598 missense probably damaging 0.99
R9290:Sned1 UTSW 1 93271663 nonsense probably null
R9560:Sned1 UTSW 1 93274388 missense probably damaging 1.00
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Z1176:Sned1 UTSW 1 93259042 missense probably damaging 1.00
Z1177:Sned1 UTSW 1 93285820 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGTGACTGTAAGGAGACCTGCC -3'
(R):5'- ACCTGCTTGTGCTACTAGACCACC -3'

Sequencing Primer
(F):5'- TAAGGAGACCTGCCTCCCTC -3'
(R):5'- TTGTCACCAACATCAGGGCTATG -3'
Posted On 2014-05-23