Incidental Mutation 'R1734:Crb2'
ID 199545
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Name crumbs family member 2
Synonyms
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1734 (G1)
Quality Score 102
Status Validated
Chromosome 2
Chromosomal Location 37776249-37799103 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37793656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1057 (C1057S)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
AlphaFold Q80YA8
Predicted Effect probably damaging
Transcript: ENSMUST00000050372
AA Change: C1057S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: C1057S

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137693
Predicted Effect probably benign
Transcript: ENSMUST00000147600
Meta Mutation Damage Score 0.9453 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
R8907:Crb2 UTSW 2 37795383 missense probably benign 0.00
R9010:Crb2 UTSW 2 37790686 missense probably benign 0.01
R9291:Crb2 UTSW 2 37792201 missense probably damaging 0.99
R9448:Crb2 UTSW 2 37787761 missense probably benign 0.01
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTCTGCTACTGGCTGAGAACTTCAC -3'
(R):5'- GCAAACCATGCTCCCTGATTCGTC -3'

Sequencing Primer
(F):5'- TGAGAACTTCACGGGCTG -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On 2014-05-23