Mutagenetix > Incidental Mutations

Incidental Mutation 'R1734:Ssfa2'

199547

Institutional Source

Beutler Lab

Gene Symbol

Ssfa2

Ensembl Gene

ENSMUSG00000027007

Gene Name

sperm specific antigen 2

Synonyms

CS1, CS-1, SPAG13, KRAP

MMRRC Submission

039766-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79635352-79672966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79657822 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 750 (V750M)

Ref Sequence

ENSEMBL: ENSMUSP00000107418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]

Predicted Effect

probably damaging
Transcript: ENSMUST00000111784
AA Change: V750M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: V750M

Domain	Start	End	E-Value	Type
low complexity region	35	57	N/A	INTRINSIC
KRAP_IP3R_bind	144	302	6.78e-81	SMART
low complexity region	357	374	N/A	INTRINSIC
low complexity region	423	445	N/A	INTRINSIC
low complexity region	743	759	N/A	INTRINSIC
Pfam:SSFA2_C	858	1029	7.5e-88	PFAM
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1144	1156	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111785
AA Change: V750M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: V750M

Domain	Start	End	E-Value	Type
low complexity region	35	57	N/A	INTRINSIC
KRAP_IP3R_bind	144	302	6.78e-81	SMART
low complexity region	357	374	N/A	INTRINSIC
low complexity region	423	445	N/A	INTRINSIC
low complexity region	743	759	N/A	INTRINSIC
Pfam:SSFA2_C	861	1029	8.9e-83	PFAM
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1166	1178	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111788
AA Change: V750M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: V750M

Domain	Start	End	E-Value	Type
low complexity region	35	57	N/A	INTRINSIC
KRAP_IP3R_bind	144	302	6.78e-81	SMART
low complexity region	357	374	N/A	INTRINSIC
low complexity region	423	445	N/A	INTRINSIC
low complexity region	743	759	N/A	INTRINSIC
Pfam:SSFA2_C	858	1029	7.4e-88	PFAM
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1166	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133266

Meta Mutation Damage Score

0.1396

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Ssfa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Ssfa2	APN	2	79657268	missense	possibly damaging	0.94
IGL00792:Ssfa2	APN	2	79657463	missense	probably benign	0.01
IGL00900:Ssfa2	APN	2	79660478	missense	probably damaging	1.00
IGL00902:Ssfa2	APN	2	79660478	missense	probably damaging	1.00
IGL01682:Ssfa2	APN	2	79635637	missense	probably damaging	1.00
IGL01683:Ssfa2	APN	2	79670725	intron	probably benign
IGL01832:Ssfa2	APN	2	79651418	missense	possibly damaging	0.94
IGL02253:Ssfa2	APN	2	79660444	missense	probably damaging	1.00
IGL02342:Ssfa2	APN	2	79660285	missense	probably benign	0.01
IGL02420:Ssfa2	APN	2	79635642	missense	probably damaging	0.99
IGL02445:Ssfa2	APN	2	79657498	missense	probably damaging	0.98
IGL02649:Ssfa2	APN	2	79641959	splice site	probably benign
IGL03242:Ssfa2	APN	2	79643471	nonsense	probably null
IGL03266:Ssfa2	APN	2	79642190	critical splice donor site	probably null
IGL03342:Ssfa2	APN	2	79660452	missense	probably damaging	1.00
IGL03352:Ssfa2	APN	2	79645101	missense	probably damaging	1.00
R0255:Ssfa2	UTSW	2	79660466	missense	probably damaging	1.00
R0526:Ssfa2	UTSW	2	79657346	missense	probably benign	0.01
R0543:Ssfa2	UTSW	2	79644506	missense	possibly damaging	0.79
R1114:Ssfa2	UTSW	2	79657529	missense	probably damaging	1.00
R1701:Ssfa2	UTSW	2	79636050	missense	probably damaging	1.00
R1945:Ssfa2	UTSW	2	79662652	missense	probably benign	0.03
R2188:Ssfa2	UTSW	2	79644923	missense	probably benign	0.01
R2941:Ssfa2	UTSW	2	79635656	missense	probably benign	0.19
R4087:Ssfa2	UTSW	2	79658347	nonsense	probably null
R4107:Ssfa2	UTSW	2	79644831	missense	probably damaging	0.97
R4355:Ssfa2	UTSW	2	79641998	missense	probably benign	0.02
R4497:Ssfa2	UTSW	2	79657820	missense	probably damaging	1.00
R4615:Ssfa2	UTSW	2	79662382	missense	probably damaging	0.99
R4726:Ssfa2	UTSW	2	79662757	missense	probably damaging	1.00
R5818:Ssfa2	UTSW	2	79644593	missense	probably damaging	1.00
R5889:Ssfa2	UTSW	2	79657728	missense	probably damaging	1.00
R6169:Ssfa2	UTSW	2	79645062	missense	probably damaging	0.99
R6337:Ssfa2	UTSW	2	79655119	missense	probably damaging	1.00
R6677:Ssfa2	UTSW	2	79655101	missense	possibly damaging	0.92
R6709:Ssfa2	UTSW	2	79644932	missense	probably benign	0.00
R6855:Ssfa2	UTSW	2	79657705	missense	probably damaging	1.00
R6856:Ssfa2	UTSW	2	79657705	missense	probably damaging	1.00
R7075:Ssfa2	UTSW	2	79635660	missense	probably damaging	0.99
R7319:Ssfa2	UTSW	2	79636072	missense	probably damaging	1.00
R7414:Ssfa2	UTSW	2	79644728	missense	possibly damaging	0.95
R7590:Ssfa2	UTSW	2	79658110	missense	possibly damaging	0.88
R7722:Ssfa2	UTSW	2	79662345	missense	probably damaging	1.00
R7923:Ssfa2	UTSW	2	79662615	nonsense	probably null
R8155:Ssfa2	UTSW	2	79644833	missense	probably benign	0.01
R8175:Ssfa2	UTSW	2	79658152	missense	probably damaging	1.00
R8237:Ssfa2	UTSW	2	79657270	missense	probably benign	0.01
R8341:Ssfa2	UTSW	2	79657718	missense	probably damaging	1.00
R8353:Ssfa2	UTSW	2	79644785	missense	probably benign	0.01
R8364:Ssfa2	UTSW	2	79651443	missense	probably damaging	0.99
R8365:Ssfa2	UTSW	2	79662345	missense	probably damaging	1.00
R8453:Ssfa2	UTSW	2	79644785	missense	probably benign	0.01
R8507:Ssfa2	UTSW	2	79644864	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCCTCTTCTGTGGACAGAGTGAAC -3'
(R):5'- GACTGGGATATTGGAGCGAACTGTG -3'

Sequencing Primer
(F):5'- AGAGTGAACACTGCCCTGC -3'
(R):5'- CATGGTGGCATTCCTCCAG -3'

Posted On

2014-05-23