Incidental Mutation 'R1734:Vps18'
ID 199548
Institutional Source Beutler Lab
Gene Symbol Vps18
Ensembl Gene ENSMUSG00000034216
Gene Name VPS18 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 039766-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1734 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119288740-119298453 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119293942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 450 (Q450L)
Ref Sequence ENSEMBL: ENSMUSP00000036915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037280]
AlphaFold Q8R307
Predicted Effect probably benign
Transcript: ENSMUST00000037280
AA Change: Q450L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: Q450L

DomainStartEndE-ValueType
Pfam:Pep3_Vps18 291 435 2.4e-41 PFAM
low complexity region 486 500 N/A INTRINSIC
Pfam:Clathrin 619 771 5.9e-11 PFAM
coiled coil region 803 845 N/A INTRINSIC
Blast:RING 853 947 3e-47 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151500
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Vps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Vps18 APN 2 119297191 missense probably benign 0.03
IGL02311:Vps18 APN 2 119290251 missense probably benign 0.05
IGL02332:Vps18 APN 2 119293810 missense probably benign 0.04
IGL03089:Vps18 APN 2 119293177 missense probably benign 0.01
IGL03114:Vps18 APN 2 119293651 missense possibly damaging 0.55
IGL03334:Vps18 APN 2 119297482 missense probably damaging 1.00
F5770:Vps18 UTSW 2 119297228 missense probably benign 0.22
R0311:Vps18 UTSW 2 119297365 missense probably benign 0.05
R0346:Vps18 UTSW 2 119297164 missense probably damaging 1.00
R0373:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R0637:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R1493:Vps18 UTSW 2 119297132 missense probably damaging 1.00
R1703:Vps18 UTSW 2 119289057 missense probably benign 0.03
R4297:Vps18 UTSW 2 119297331 nonsense probably null
R4633:Vps18 UTSW 2 119293276 missense probably damaging 1.00
R4729:Vps18 UTSW 2 119293791 missense probably damaging 1.00
R5034:Vps18 UTSW 2 119293306 missense probably benign 0.00
R5162:Vps18 UTSW 2 119292942 missense probably benign 0.19
R5320:Vps18 UTSW 2 119297377 nonsense probably null
R5857:Vps18 UTSW 2 119297533 missense probably damaging 1.00
R6105:Vps18 UTSW 2 119289062 missense probably damaging 1.00
R6150:Vps18 UTSW 2 119297592 nonsense probably null
R7934:Vps18 UTSW 2 119293641 missense probably benign 0.11
R8018:Vps18 UTSW 2 119294011 missense probably damaging 1.00
R8147:Vps18 UTSW 2 119292756 missense probably benign 0.19
R8401:Vps18 UTSW 2 119297492 missense probably damaging 0.96
R8525:Vps18 UTSW 2 119290230 missense possibly damaging 0.68
R9044:Vps18 UTSW 2 119297553 missense probably damaging 1.00
R9719:Vps18 UTSW 2 119297072 missense probably damaging 1.00
RF002:Vps18 UTSW 2 119297390 missense probably damaging 1.00
V7583:Vps18 UTSW 2 119297228 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAGAAGTTTGGACCACTGAGGCAC -3'
(R):5'- AGAGAGTCAGAGCATCTGGGTCAC -3'

Sequencing Primer
(F):5'- GCTACCATGTGCAACGTGAG -3'
(R):5'- CATCTGGGTCACCCTGC -3'
Posted On 2014-05-23