Incidental Mutation 'R1734:Chac1'
ID 199549
Institutional Source Beutler Lab
Gene Symbol Chac1
Ensembl Gene ENSMUSG00000027313
Gene Name ChaC, cation transport regulator 1
Synonyms Botch, 1810008K03Rik
MMRRC Submission 039766-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1734 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119351229-119354381 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119353458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 180 (L180F)
Ref Sequence ENSEMBL: ENSMUSP00000028780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028780]
AlphaFold Q8R3J5
Predicted Effect probably damaging
Transcript: ENSMUST00000028780
AA Change: L180F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028780
Gene: ENSMUSG00000027313
AA Change: L180F

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:ChaC 34 209 2.2e-71 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Chac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Chac1 APN 2 119353559 missense probably benign
IGL02611:Chac1 APN 2 119353453 missense probably damaging 1.00
PIT4366001:Chac1 UTSW 2 119351505 missense probably damaging 1.00
R0218:Chac1 UTSW 2 119353460 nonsense probably null
R0862:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R0864:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R5398:Chac1 UTSW 2 119353244 missense possibly damaging 0.92
R5609:Chac1 UTSW 2 119351406 missense unknown
R5641:Chac1 UTSW 2 119351518 missense probably damaging 1.00
R6416:Chac1 UTSW 2 119353534 missense probably damaging 0.98
R7877:Chac1 UTSW 2 119353506 missense probably damaging 1.00
R8954:Chac1 UTSW 2 119353355 missense probably damaging 1.00
R9360:Chac1 UTSW 2 119352373 missense probably damaging 1.00
R9426:Chac1 UTSW 2 119353433 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACGAGGCCCTGAAGTACCTGAATG -3'
(R):5'- GCATACTGATGTCCACCAGTACCAC -3'

Sequencing Primer
(F):5'- CCCTGAAGTACCTGAATGTGAGG -3'
(R):5'- AGTACCACTCAGACACTTCTTG -3'
Posted On 2014-05-23